ID: 1046714222

View in Genome Browser
Species Human (GRCh38)
Location 8:117549568-117549590
Sequence GGCCATTGTTGGCCTGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046714216_1046714222 22 Left 1046714216 8:117549523-117549545 CCAATGCCTTTTCAATTCCACTC No data
Right 1046714222 8:117549568-117549590 GGCCATTGTTGGCCTGACAATGG No data
1046714218_1046714222 5 Left 1046714218 8:117549540-117549562 CCACTCAAGACAGAAAGAAGACT No data
Right 1046714222 8:117549568-117549590 GGCCATTGTTGGCCTGACAATGG No data
1046714217_1046714222 16 Left 1046714217 8:117549529-117549551 CCTTTTCAATTCCACTCAAGACA No data
Right 1046714222 8:117549568-117549590 GGCCATTGTTGGCCTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046714222 Original CRISPR GGCCATTGTTGGCCTGACAA TGG Intergenic
No off target data available for this crispr