ID: 1046717039

View in Genome Browser
Species Human (GRCh38)
Location 8:117579328-117579350
Sequence CCATATAAGTTACAGTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046717034_1046717039 18 Left 1046717034 8:117579287-117579309 CCTGGGGCAGGAGTGTGGCTGGA No data
Right 1046717039 8:117579328-117579350 CCATATAAGTTACAGTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046717039 Original CRISPR CCATATAAGTTACAGTGGGT TGG Intergenic
No off target data available for this crispr