ID: 1046717458

View in Genome Browser
Species Human (GRCh38)
Location 8:117583457-117583479
Sequence GTATGTGCTTTGGTTTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046717451_1046717458 25 Left 1046717451 8:117583409-117583431 CCTTTTTTAAGGAGTCATTGTAA No data
Right 1046717458 8:117583457-117583479 GTATGTGCTTTGGTTTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046717458 Original CRISPR GTATGTGCTTTGGTTTGGTA AGG Intergenic
No off target data available for this crispr