ID: 1046720373

View in Genome Browser
Species Human (GRCh38)
Location 8:117612264-117612286
Sequence AGTTATAAGAGGAAACTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046720367_1046720373 2 Left 1046720367 8:117612239-117612261 CCATGTGAAGGATTCTGGATGAA No data
Right 1046720373 8:117612264-117612286 AGTTATAAGAGGAAACTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046720373 Original CRISPR AGTTATAAGAGGAAACTGGG GGG Intergenic
No off target data available for this crispr