ID: 1046728209

View in Genome Browser
Species Human (GRCh38)
Location 8:117697099-117697121
Sequence ATAAGTTTTTTACAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046728209_1046728214 15 Left 1046728209 8:117697099-117697121 CCAGCACTCTGTAAAAAACTTAT No data
Right 1046728214 8:117697137-117697159 GATGCTGGAAATTCACATATTGG No data
1046728209_1046728211 0 Left 1046728209 8:117697099-117697121 CCAGCACTCTGTAAAAAACTTAT No data
Right 1046728211 8:117697122-117697144 CCAACCAGCTCCACTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046728209 Original CRISPR ATAAGTTTTTTACAGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr