ID: 1046728816

View in Genome Browser
Species Human (GRCh38)
Location 8:117703449-117703471
Sequence CTGCAGTTCTGGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046728806_1046728816 23 Left 1046728806 8:117703403-117703425 CCTCTGCTGCCATAATGCCTCAA No data
Right 1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG No data
1046728812_1046728816 -6 Left 1046728812 8:117703432-117703454 CCTGGTATTGACAAGGGCTGCAG No data
Right 1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG No data
1046728809_1046728816 6 Left 1046728809 8:117703420-117703442 CCTCAAAATATACCTGGTATTGA No data
Right 1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG No data
1046728807_1046728816 14 Left 1046728807 8:117703412-117703434 CCATAATGCCTCAAAATATACCT No data
Right 1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046728816 Original CRISPR CTGCAGTTCTGGAAGGAAGG TGG Intergenic
No off target data available for this crispr