ID: 1046736056

View in Genome Browser
Species Human (GRCh38)
Location 8:117777782-117777804
Sequence ACTGGGTGGCTGCCGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736056_1046736073 30 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736056_1046736066 16 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736056_1046736060 -10 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736056_1046736069 22 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736069 8:117777827-117777849 GCCCCGCAGCCGCCCGGCCTGGG No data
1046736056_1046736068 21 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736056 Original CRISPR ACTGGGTGGCTGCCGGGCGG AGG (reversed) Intergenic