ID: 1046736057

View in Genome Browser
Species Human (GRCh38)
Location 8:117777785-117777807
Sequence CAGACTGGGTGGCTGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736057_1046736066 13 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736057_1046736069 19 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736069 8:117777827-117777849 GCCCCGCAGCCGCCCGGCCTGGG No data
1046736057_1046736068 18 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736057_1046736073 27 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736057 Original CRISPR CAGACTGGGTGGCTGCCGGG CGG (reversed) Intergenic