ID: 1046736058

View in Genome Browser
Species Human (GRCh38)
Location 8:117777788-117777810
Sequence TCTCAGACTGGGTGGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736058_1046736073 24 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG 0: 3
1: 32
2: 937
3: 9700
4: 9590
1046736058_1046736066 10 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736058_1046736069 16 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736069 8:117777827-117777849 GCCCCGCAGCCGCCCGGCCTGGG 0: 1
1: 0
2: 13
3: 326
4: 1613
1046736058_1046736068 15 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736058 Original CRISPR TCTCAGACTGGGTGGCTGCC GGG (reversed) Intergenic