ID: 1046736060

View in Genome Browser
Species Human (GRCh38)
Location 8:117777795-117777817
Sequence GCCACCCAGTCTGAGAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736056_1046736060 -10 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736054_1046736060 -8 Left 1046736054 8:117777780-117777802 CCCCTCCGCCCGGCAGCCACCCA No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736047_1046736060 20 Left 1046736047 8:117777752-117777774 CCAGCCGCCCCGTCTGAGAAGTG No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736055_1046736060 -9 Left 1046736055 8:117777781-117777803 CCCTCCGCCCGGCAGCCACCCAG No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736049_1046736060 16 Left 1046736049 8:117777756-117777778 CCGCCCCGTCTGAGAAGTGAGGA No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736052_1046736060 11 Left 1046736052 8:117777761-117777783 CCGTCTGAGAAGTGAGGAGCCCC No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736050_1046736060 13 Left 1046736050 8:117777759-117777781 CCCCGTCTGAGAAGTGAGGAGCC No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data
1046736051_1046736060 12 Left 1046736051 8:117777760-117777782 CCCGTCTGAGAAGTGAGGAGCCC No data
Right 1046736060 8:117777795-117777817 GCCACCCAGTCTGAGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736060 Original CRISPR GCCACCCAGTCTGAGAAGTG AGG Intergenic