ID: 1046736063

View in Genome Browser
Species Human (GRCh38)
Location 8:117777800-117777822
Sequence GGGCTCCTCACTTCTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736063_1046736069 4 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC No data
Right 1046736069 8:117777827-117777849 GCCCCGCAGCCGCCCGGCCTGGG No data
1046736063_1046736068 3 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736063_1046736073 12 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736063_1046736066 -2 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736063 Original CRISPR GGGCTCCTCACTTCTCAGAC TGG (reversed) Intergenic