ID: 1046736066

View in Genome Browser
Species Human (GRCh38)
Location 8:117777821-117777843
Sequence CCCTCTGCCCCGCAGCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736061_1046736066 2 Left 1046736061 8:117777796-117777818 CCACCCAGTCTGAGAAGTGAGGA No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736055_1046736066 17 Left 1046736055 8:117777781-117777803 CCCTCCGCCCGGCAGCCACCCAG No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736057_1046736066 13 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736056_1046736066 16 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736063_1046736066 -2 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736062_1046736066 -1 Left 1046736062 8:117777799-117777821 CCCAGTCTGAGAAGTGAGGAGCC No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736059_1046736066 9 Left 1046736059 8:117777789-117777811 CCGGCAGCCACCCAGTCTGAGAA No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736058_1046736066 10 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
1046736054_1046736066 18 Left 1046736054 8:117777780-117777802 CCCCTCCGCCCGGCAGCCACCCA No data
Right 1046736066 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736066 Original CRISPR CCCTCTGCCCCGCAGCCGCC CGG Intergenic