ID: 1046736067

View in Genome Browser
Species Human (GRCh38)
Location 8:117777822-117777844
Sequence GCCGGGCGGCTGCGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736067_1046736079 21 Left 1046736067 8:117777822-117777844 CCTCTGCCCCGCAGCCGCCCGGC No data
Right 1046736079 8:117777866-117777888 CGCCCAGCAGCCGCCCCGTCCGG No data
1046736067_1046736073 -10 Left 1046736067 8:117777822-117777844 CCTCTGCCCCGCAGCCGCCCGGC No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736067_1046736083 25 Left 1046736067 8:117777822-117777844 CCTCTGCCCCGCAGCCGCCCGGC No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736067_1046736080 22 Left 1046736067 8:117777822-117777844 CCTCTGCCCCGCAGCCGCCCGGC No data
Right 1046736080 8:117777867-117777889 GCCCAGCAGCCGCCCCGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736067 Original CRISPR GCCGGGCGGCTGCGGGGCAG AGG (reversed) Intergenic