ID: 1046736068

View in Genome Browser
Species Human (GRCh38)
Location 8:117777826-117777848
Sequence TGCCCCGCAGCCGCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736054_1046736068 23 Left 1046736054 8:117777780-117777802 CCCCTCCGCCCGGCAGCCACCCA 0: 7
1: 579
2: 1089
3: 1196
4: 1921
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736062_1046736068 4 Left 1046736062 8:117777799-117777821 CCCAGTCTGAGAAGTGAGGAGCC 0: 22
1: 1859
2: 2187
3: 4507
4: 8217
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736059_1046736068 14 Left 1046736059 8:117777789-117777811 CCGGCAGCCACCCAGTCTGAGAA No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736061_1046736068 7 Left 1046736061 8:117777796-117777818 CCACCCAGTCTGAGAAGTGAGGA 0: 26
1: 2605
2: 3658
3: 3754
4: 6445
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736055_1046736068 22 Left 1046736055 8:117777781-117777803 CCCTCCGCCCGGCAGCCACCCAG 0: 4
1: 306
2: 989
3: 1254
4: 2206
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736058_1046736068 15 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736063_1046736068 3 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC 0: 1555
1: 1910
2: 1784
3: 7700
4: 7503
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736057_1046736068 18 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data
1046736056_1046736068 21 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736068 Original CRISPR TGCCCCGCAGCCGCCCGGCC TGG Intergenic
No off target data available for this crispr