ID: 1046736073

View in Genome Browser
Species Human (GRCh38)
Location 8:117777835-117777857
Sequence GCCGCCCGGCCTGGGAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736067_1046736073 -10 Left 1046736067 8:117777822-117777844 CCTCTGCCCCGCAGCCGCCCGGC No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736061_1046736073 16 Left 1046736061 8:117777796-117777818 CCACCCAGTCTGAGAAGTGAGGA No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736058_1046736073 24 Left 1046736058 8:117777788-117777810 CCCGGCAGCCACCCAGTCTGAGA No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736065_1046736073 -9 Left 1046736065 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736056_1046736073 30 Left 1046736056 8:117777782-117777804 CCTCCGCCCGGCAGCCACCCAGT No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736062_1046736073 13 Left 1046736062 8:117777799-117777821 CCCAGTCTGAGAAGTGAGGAGCC No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736059_1046736073 23 Left 1046736059 8:117777789-117777811 CCGGCAGCCACCCAGTCTGAGAA No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736064_1046736073 -8 Left 1046736064 8:117777820-117777842 CCCCTCTGCCCCGCAGCCGCCCG No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736063_1046736073 12 Left 1046736063 8:117777800-117777822 CCAGTCTGAGAAGTGAGGAGCCC No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data
1046736057_1046736073 27 Left 1046736057 8:117777785-117777807 CCGCCCGGCAGCCACCCAGTCTG No data
Right 1046736073 8:117777835-117777857 GCCGCCCGGCCTGGGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736073 Original CRISPR GCCGCCCGGCCTGGGAAGTG AGG Intergenic