ID: 1046736083

View in Genome Browser
Species Human (GRCh38)
Location 8:117777870-117777892
Sequence CAGCAGCCGCCCCGTCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046736071_1046736083 18 Left 1046736071 8:117777829-117777851 CCCGCAGCCGCCCGGCCTGGGAA No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736064_1046736083 27 Left 1046736064 8:117777820-117777842 CCCCTCTGCCCCGCAGCCGCCCG No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736070_1046736083 19 Left 1046736070 8:117777828-117777850 CCCCGCAGCCGCCCGGCCTGGGA No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736076_1046736083 7 Left 1046736076 8:117777840-117777862 CCGGCCTGGGAAGTGAGGAGCGT No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736067_1046736083 25 Left 1046736067 8:117777822-117777844 CCTCTGCCCCGCAGCCGCCCGGC No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736065_1046736083 26 Left 1046736065 8:117777821-117777843 CCCTCTGCCCCGCAGCCGCCCGG No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736077_1046736083 3 Left 1046736077 8:117777844-117777866 CCTGGGAAGTGAGGAGCGTCTCC No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736074_1046736083 11 Left 1046736074 8:117777836-117777858 CCGCCCGGCCTGGGAAGTGAGGA No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736072_1046736083 17 Left 1046736072 8:117777830-117777852 CCGCAGCCGCCCGGCCTGGGAAG No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data
1046736075_1046736083 8 Left 1046736075 8:117777839-117777861 CCCGGCCTGGGAAGTGAGGAGCG No data
Right 1046736083 8:117777870-117777892 CAGCAGCCGCCCCGTCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046736083 Original CRISPR CAGCAGCCGCCCCGTCCGGG AGG Intergenic