ID: 1046739188

View in Genome Browser
Species Human (GRCh38)
Location 8:117810763-117810785
Sequence TGCCCTGTGCCCTCAGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046739184_1046739188 6 Left 1046739184 8:117810734-117810756 CCAAAATCCACTATCCACTCTTC 0: 1
1: 1
2: 4
3: 29
4: 276
Right 1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG No data
1046739182_1046739188 10 Left 1046739182 8:117810730-117810752 CCCTCCAAAATCCACTATCCACT 0: 1
1: 0
2: 1
3: 27
4: 255
Right 1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG No data
1046739185_1046739188 -1 Left 1046739185 8:117810741-117810763 CCACTATCCACTCTTCTTGTCCT 0: 1
1: 0
2: 2
3: 16
4: 368
Right 1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG No data
1046739186_1046739188 -8 Left 1046739186 8:117810748-117810770 CCACTCTTCTTGTCCTGCCCTGT 0: 1
1: 0
2: 0
3: 42
4: 519
Right 1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG No data
1046739181_1046739188 20 Left 1046739181 8:117810720-117810742 CCTGTGTTTGCCCTCCAAAATCC 0: 1
1: 0
2: 2
3: 17
4: 216
Right 1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG No data
1046739183_1046739188 9 Left 1046739183 8:117810731-117810753 CCTCCAAAATCCACTATCCACTC 0: 1
1: 0
2: 1
3: 18
4: 208
Right 1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046739188 Original CRISPR TGCCCTGTGCCCTCAGATAA TGG Intronic
No off target data available for this crispr