ID: 1046739586

View in Genome Browser
Species Human (GRCh38)
Location 8:117813974-117813996
Sequence TCTCACTCTGTCACCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584294
Summary {0: 30388, 1: 79844, 2: 153170, 3: 168549, 4: 152343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046739586_1046739588 28 Left 1046739586 8:117813974-117813996 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046739586 Original CRISPR TCTCACTCTGTCACCCAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr