ID: 1046739587 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:117813978-117814000 |
| Sequence | AGAGTCTCACTCTGTCACCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 467018 | |||
| Summary | {0: 9650, 1: 44791, 2: 100947, 3: 156345, 4: 155285} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046739587_1046739588 | 24 | Left | 1046739587 | 8:117813978-117814000 | CCTGGGTGACAGAGTGAGACTCT | 0: 9650 1: 44791 2: 100947 3: 156345 4: 155285 |
||
| Right | 1046739588 | 8:117814025-117814047 | AAGAAGAAGAAGAAAGAAGAAGG | 0: 16 1: 101 2: 331 3: 1363 4: 7127 |
||||
| 1046739587_1046739589 | 27 | Left | 1046739587 | 8:117813978-117814000 | CCTGGGTGACAGAGTGAGACTCT | 0: 9650 1: 44791 2: 100947 3: 156345 4: 155285 |
||
| Right | 1046739589 | 8:117814028-117814050 | AAGAAGAAGAAAGAAGAAGGAGG | 0: 13 1: 74 2: 289 3: 1144 4: 5844 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046739587 | Original CRISPR | AGAGTCTCACTCTGTCACCC AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||