ID: 1046739587

View in Genome Browser
Species Human (GRCh38)
Location 8:117813978-117814000
Sequence AGAGTCTCACTCTGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467018
Summary {0: 9650, 1: 44791, 2: 100947, 3: 156345, 4: 155285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046739587_1046739588 24 Left 1046739587 8:117813978-117814000 CCTGGGTGACAGAGTGAGACTCT 0: 9650
1: 44791
2: 100947
3: 156345
4: 155285
Right 1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127
1046739587_1046739589 27 Left 1046739587 8:117813978-117814000 CCTGGGTGACAGAGTGAGACTCT 0: 9650
1: 44791
2: 100947
3: 156345
4: 155285
Right 1046739589 8:117814028-117814050 AAGAAGAAGAAAGAAGAAGGAGG 0: 13
1: 74
2: 289
3: 1144
4: 5844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046739587 Original CRISPR AGAGTCTCACTCTGTCACCC AGG (reversed) Intronic
Too many off-targets to display for this crispr