ID: 1046739588

View in Genome Browser
Species Human (GRCh38)
Location 8:117814025-117814047
Sequence AAGAAGAAGAAGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8938
Summary {0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046739586_1046739588 28 Left 1046739586 8:117813974-117813996 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127
1046739587_1046739588 24 Left 1046739587 8:117813978-117814000 CCTGGGTGACAGAGTGAGACTCT 0: 9650
1: 44791
2: 100947
3: 156345
4: 155285
Right 1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG 0: 16
1: 101
2: 331
3: 1363
4: 7127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046739588 Original CRISPR AAGAAGAAGAAGAAAGAAGA AGG Intronic
Too many off-targets to display for this crispr