ID: 1046746945

View in Genome Browser
Species Human (GRCh38)
Location 8:117886367-117886389
Sequence ATTTCTAGTAGAGCTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046746945_1046746946 -7 Left 1046746945 8:117886367-117886389 CCAGTGGGAGCTCTACTAGAAAT 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1046746946 8:117886383-117886405 TAGAAATACTACTACACAAGTGG No data
1046746945_1046746948 26 Left 1046746945 8:117886367-117886389 CCAGTGGGAGCTCTACTAGAAAT 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1046746948 8:117886416-117886438 AATTTGATGACACAAATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046746945 Original CRISPR ATTTCTAGTAGAGCTCCCAC TGG (reversed) Intronic
905237523 1:36560400-36560422 CTTTCTAGTAGGGGTCCCACGGG + Intergenic
913001312 1:114583146-114583168 ATGTCTAGTAGAAGCCCCACTGG + Exonic
916586477 1:166154183-166154205 ATTTCTTCTAGAGCTGCCAGGGG + Intronic
916890923 1:169111664-169111686 ATTGCAGGCAGAGCTCCCACGGG + Intronic
917930086 1:179817042-179817064 ATTTGAAGTAGAAATCCCACAGG + Intergenic
919722769 1:200857069-200857091 ATTTTTAGTACTGCTCTCACAGG + Intronic
1064136133 10:12752338-12752360 AGTTTTAGTAGAGATCCCATTGG + Intronic
1065404209 10:25345241-25345263 AGGCTTAGTAGAGCTCCCACTGG - Intronic
1066634715 10:37489309-37489331 ATTGCTAAGAGACCTCCCACTGG + Intergenic
1070401147 10:76054770-76054792 TCCTCCAGTAGAGCTCCCACCGG - Intronic
1072905362 10:99448096-99448118 ATCTCCAGAAGTGCTCCCACAGG + Intergenic
1074977178 10:118590947-118590969 ATTACTAGAAAAGCTGCCACTGG - Exonic
1075807956 10:125203607-125203629 AGTTCTGGGAGGGCTCCCACAGG - Intergenic
1076103776 10:127803980-127804002 ATTTCCACTACTGCTCCCACTGG + Intergenic
1081287295 11:41286518-41286540 CATTCTATTAGAGCTCTCACTGG - Intronic
1083456253 11:62780756-62780778 ATTTTTAGTAGATATCCAACGGG - Intronic
1085911469 11:80832035-80832057 TTTTCTAGAAGAGCTCACACAGG + Intergenic
1093605303 12:21081662-21081684 ATTCCTAGAAGTACTCCCACTGG - Intronic
1094792150 12:33928090-33928112 ATTTCTGTTAGAAGTCCCACTGG - Intergenic
1095575590 12:43734666-43734688 TTTTCTAGTAGAGACCCAACAGG + Intronic
1095923708 12:47557541-47557563 ATTTCTTGTAAAGCTGCCTCAGG + Intergenic
1098413599 12:70207796-70207818 ATTTCTAGTAGAGCTAACACAGG + Intergenic
1108247771 13:48534139-48534161 ATTTCTTGTAGAGCTCTAAATGG + Intergenic
1111700310 13:91679079-91679101 ATTACTAAAAGAGCTTCCACTGG - Intronic
1112723883 13:102279808-102279830 ATTTCAAATAGAGTTCCCAAAGG - Intronic
1114613722 14:24057665-24057687 ATCTCCAGTGGAGCTCACACAGG + Intronic
1118068455 14:62218220-62218242 ATATATAGTAGAGCTCACATAGG - Intergenic
1118645423 14:67833978-67834000 ATTTGTATTAGAACTGCCACAGG - Intronic
1123929979 15:25162819-25162841 ATTTATTGTAGAGCTCACAGTGG + Intergenic
1131899587 15:97072889-97072911 TGTTCTAGCAGAGCTCCCAGAGG - Intergenic
1132916507 16:2349145-2349167 ATTTTTAGTAGAGACCCTACTGG + Intergenic
1138126044 16:54439419-54439441 ATTTCTAAAAGAGCTCACAGAGG + Intergenic
1139249511 16:65481451-65481473 CTTTCTAGTAGAGCGACCTCAGG + Intergenic
1139374728 16:66489844-66489866 TTTTCGAGTAGAACTCCAACTGG + Intronic
1143694574 17:8602472-8602494 ATTGCTGGTAAAGCTCACACCGG - Intronic
1144438213 17:15260140-15260162 ATTGTTAGTAAAGCTTCCACTGG - Intronic
1153601410 18:6784237-6784259 ATTTCTAACAAAGCTCCCAGGGG - Intronic
1166317743 19:41998403-41998425 ATTTCTATGAGACCTCCCCCAGG - Exonic
1167857223 19:52252395-52252417 AATTCCAGTAGAGCTCCCAGTGG + Intergenic
927771539 2:25866470-25866492 ATTTCTTATAGACCTCCCATAGG - Intronic
937244096 2:120481507-120481529 ATGTCTATCAGAGCTCCCAGGGG - Intergenic
944330423 2:198459015-198459037 ATATCTAGTAGATTTCTCACAGG + Intronic
944946251 2:204689302-204689324 TTTCCTAGTACAGCTTCCACGGG + Intronic
1172248201 20:33460591-33460613 CTCACTGGTAGAGCTCCCACAGG - Intergenic
1178201120 21:30406606-30406628 ATTTCTATTAGATCTCTCATGGG + Intronic
951165473 3:19480566-19480588 ATTTCTATAAGAGCTCTCATAGG - Intronic
957047244 3:75385576-75385598 ATTTCTATTAGGGACCCCACGGG + Intergenic
957892232 3:86375434-86375456 ATTTTTACTAAAGCTCCGACAGG + Intergenic
963874545 3:150460638-150460660 ATTCCAAGTAGAGCTGCTACAGG + Exonic
969823809 4:9740825-9740847 ATTTCTACTAGGGACCCCACGGG - Intergenic
979178866 4:117700557-117700579 ATTACAAGTAGATCTGCCACAGG + Intergenic
979411005 4:120379828-120379850 AATTCTAGGAGGGCTCCTACTGG + Intergenic
981491420 4:145344412-145344434 CTTTCTAGAAGAGCAGCCACAGG + Intergenic
981503364 4:145475611-145475633 ATTTATAGTTCAGCTCCCTCAGG - Intergenic
993007434 5:82443760-82443782 ACTTCTGGTAGACCTCCCCCAGG + Intergenic
995173571 5:109146365-109146387 ATTTCTACTTGTGCTCCCAAGGG - Intronic
995726329 5:115184602-115184624 ATTACCAGAATAGCTCCCACTGG + Intergenic
997396114 5:133561252-133561274 ATTTTTACTAGAGCTCTTACAGG - Intronic
1000291012 5:159871458-159871480 ATCTCTTGTAGAGCCTCCACAGG - Intergenic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1010285224 6:74069350-74069372 CTTTCTAGTACAGCTCTCACTGG + Intergenic
1015296901 6:131605360-131605382 GTTTCTACCAGAGCTCCCATGGG + Exonic
1018687250 6:166313337-166313359 ATTGCTAGTACTGCTCTCACAGG - Intergenic
1023602934 7:41898467-41898489 ATTTTTAAAAGAGCACCCACAGG - Intergenic
1027758540 7:82248085-82248107 ATCTCCAGTAGAGTTACCACTGG - Intronic
1030081527 7:105782704-105782726 ATTTCTAAAAGAGCTGCCATAGG + Intronic
1037775945 8:21835782-21835804 ATTTCTAGCAGATCTCTCAAGGG + Intergenic
1042297458 8:67236966-67236988 ACTTCTAGAAGATATCCCACTGG + Intronic
1042867614 8:73369457-73369479 CTTTCTAGCAGGGCTCCCCCAGG - Intergenic
1043147196 8:76673675-76673697 ATTTCGAGTTGAACTCCCAGGGG - Intergenic
1046746945 8:117886367-117886389 ATTTCTAGTAGAGCTCCCACTGG - Intronic
1053408341 9:37897708-37897730 ATCCCTAGGAGAGTTCCCACAGG - Intronic
1060779487 9:126400977-126400999 TTTTCTAGGAGAGCCCCCGCAGG - Intronic
1186614163 X:11169414-11169436 AATTCTAGTAGACCACCCTCTGG - Intronic
1187041100 X:15596891-15596913 ATAACTAGTACAGCTCCCACAGG + Intronic
1196365576 X:114919674-114919696 GTTTTTATTAGAGCTACCACAGG + Intergenic