ID: 1046747201

View in Genome Browser
Species Human (GRCh38)
Location 8:117888991-117889013
Sequence CTCCTGGTGAACCACCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046747201_1046747204 -2 Left 1046747201 8:117888991-117889013 CCCTGATGGTGGTTCACCAGGAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1046747204 8:117889012-117889034 AGCTCCTGCAGCCACGTAAGAGG No data
1046747201_1046747205 -1 Left 1046747201 8:117888991-117889013 CCCTGATGGTGGTTCACCAGGAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1046747205 8:117889013-117889035 GCTCCTGCAGCCACGTAAGAGGG No data
1046747201_1046747209 23 Left 1046747201 8:117888991-117889013 CCCTGATGGTGGTTCACCAGGAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1046747209 8:117889037-117889059 ATAGAAAGTGTTATTTCCAAGGG No data
1046747201_1046747210 28 Left 1046747201 8:117888991-117889013 CCCTGATGGTGGTTCACCAGGAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1046747210 8:117889042-117889064 AAGTGTTATTTCCAAGGGAGAGG No data
1046747201_1046747208 22 Left 1046747201 8:117888991-117889013 CCCTGATGGTGGTTCACCAGGAG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1046747208 8:117889036-117889058 TATAGAAAGTGTTATTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046747201 Original CRISPR CTCCTGGTGAACCACCATCA GGG (reversed) Intronic
904235713 1:29115754-29115776 CTCCTGGTGGACGACCACCTTGG - Exonic
905206743 1:36346963-36346985 CTCCTGGGGCACCACCCCCATGG - Intronic
905369484 1:37475442-37475464 CTCCTACTGAACAACCAACAGGG - Exonic
906867043 1:49433053-49433075 CTCCAGGTGTACCACCCTCCAGG - Intronic
917988297 1:180345238-180345260 CTTCTGGTCATTCACCATCAAGG - Intronic
918279814 1:182993407-182993429 CTCCTGTGTAACCACCATCCAGG - Intergenic
919018716 1:192075560-192075582 CGCCTGGTGCACCACCTTCCAGG - Intergenic
920199162 1:204248932-204248954 CTCCTGGTGGGTCCCCATCAAGG + Exonic
922231264 1:223688839-223688861 CTCCTGGAAAACCAGCAACAAGG + Intergenic
923800716 1:237205821-237205843 CTCCTGCTGAGGCCCCATCACGG - Intronic
1067967719 10:50932321-50932343 TTCCTGTAGAAACACCATCATGG + Intergenic
1072989678 10:100180132-100180154 CTCCTGGTGAACCAACAATCTGG + Intronic
1075786066 10:125051001-125051023 CTCATCGTGAGCTACCATCAGGG + Intronic
1079173133 11:18115144-18115166 CCCCAGTAGAACCACCATCAAGG + Intronic
1081240119 11:40695193-40695215 ATCCTGGTGAGGCACCATGAAGG + Intronic
1083993148 11:66258599-66258621 CTCCCGCGGAAACACCATCATGG - Exonic
1085699601 11:78734356-78734378 CTTCTATAGAACCACCATCAAGG + Intronic
1091667975 12:2432882-2432904 TTCCAGGTGAACCACCAGGAAGG + Intronic
1093079097 12:14788973-14788995 CTCCTCGTGGACCCCCACCAAGG - Exonic
1099495710 12:83343442-83343464 CTCATGGAGAACCACTATTAGGG + Intergenic
1105288642 13:19030198-19030220 CTCCTTGGGCACCTCCATCAGGG + Intergenic
1109502470 13:63255685-63255707 CTCATGGAGAACCACCACTAGGG - Intergenic
1112358822 13:98697870-98697892 GTCCTGCTGAACCACTATCCTGG - Intronic
1114821980 14:26031861-26031883 TTCCTGGTGAAAGATCATCATGG - Intergenic
1117984540 14:61374448-61374470 CTCATGGTGAACCTCTATGAGGG - Intronic
1118215926 14:63808527-63808549 CCCCTGCTGCGCCACCATCATGG + Intergenic
1118955059 14:70473406-70473428 CTCCTTGTGCACAATCATCAAGG + Intergenic
1119331134 14:73794708-73794730 CTTCTGGTGACCCAGCATCCTGG - Intergenic
1120225868 14:81790459-81790481 CTCATGGAGAACCTCTATCAGGG + Intergenic
1120560856 14:85990558-85990580 CTCCAGGTGCACCACCTTCCAGG - Intergenic
1121035366 14:90698995-90699017 CTCCTGCTGAACCTCCTTCCAGG + Intronic
1123875243 15:24617539-24617561 CTCATGGAGAACCACCACTAGGG - Intergenic
1126828338 15:52573460-52573482 CTCCTTGTACACCTCCATCAGGG - Intergenic
1134818114 16:17222894-17222916 CTCTTCGTGAACCACACTCAGGG + Intronic
1136269341 16:29139289-29139311 CTCCAGGGGAACCCCCACCAAGG + Intergenic
1137847860 16:51709686-51709708 CTCCTTGGCAACCACCATGAAGG + Intergenic
1139499843 16:67353741-67353763 CACCTGTAGAACCACCTTCAAGG - Intronic
1140617373 16:76682699-76682721 CACCTGGTAAAACACCACCAGGG + Intergenic
1146677751 17:34785176-34785198 CTCCTGGGGGACCACCATCCTGG + Intergenic
1146909139 17:36637055-36637077 CTCCTGGTGGACTGTCATCAAGG + Intergenic
1151446733 17:74171126-74171148 CTCCTATTGCACAACCATCAGGG - Intergenic
1156012754 18:32513228-32513250 CTCCTCGGGAACCCCCACCAAGG + Intergenic
1156122657 18:33863820-33863842 CTCATGGAGAACCTCCATTAGGG - Intronic
1157826317 18:50815479-50815501 ATCCTGGTCCACCACCACCACGG - Intronic
1161022555 19:2016919-2016941 ATCCTGGTGAAACCCCATCATGG + Intronic
1161459614 19:4389047-4389069 CTGCTGTTGAGCCACCACCAGGG + Intronic
1162793275 19:13073906-13073928 CTCCTGTTGCAACAGCATCAGGG + Exonic
927254510 2:21028490-21028512 CTCCCGGAGAAGCATCATCAAGG + Exonic
932964462 2:76455292-76455314 CTCCAGGTGCACCACCCTCTAGG - Intergenic
939958360 2:148545510-148545532 CTCCTGGGGGACCATCATCTTGG - Intergenic
942526801 2:176861707-176861729 CTCCAGGTGCACCACCCTCCAGG + Intergenic
1171147013 20:22793581-22793603 CTCCTCATCAGCCACCATCAGGG - Intergenic
1175467884 20:59204844-59204866 CTCCTGGAGAAGCAGCATCCTGG - Intronic
1179531965 21:42025938-42025960 CTCCTGGTGACCCCTCCTCACGG + Intergenic
1184386605 22:44180128-44180150 CTCATGGTGAACCAGCAGAAGGG - Intronic
949171125 3:998447-998469 CTCCTGGTGCACCACCCCCCAGG - Intergenic
952300354 3:32099411-32099433 CTCCTGGTGAAACCCTATAATGG + Intergenic
956195323 3:66648581-66648603 CTCCAGGAGAAGCACCATGAGGG - Intergenic
959740528 3:109713826-109713848 CTCCAGGTGAACCTCCAAAAAGG - Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
965404851 3:168255813-168255835 CTCATGGAGAACCTCCATTAGGG - Intergenic
969588601 4:8108707-8108729 CTCCTGGTGAGCCCCCATGGAGG - Intronic
974049961 4:56931209-56931231 CTCCTTCTGAACCACCCCCATGG - Exonic
977050145 4:92119398-92119420 CTCATGGTGAACCTCTATTAGGG + Intergenic
979976620 4:127204569-127204591 CTCTTCGTGAACTACCAACAAGG - Intergenic
993404547 5:87494980-87495002 CTCCTGATGAAACAGTATCAGGG + Intergenic
995678150 5:114686357-114686379 CAGCTGCTGAACCACCACCAAGG - Intergenic
997650998 5:135520551-135520573 CTCCTGGTGCACCACCCTCCAGG + Intergenic
1003144588 6:3499136-3499158 TTCCTGCAGAACCACCATGAAGG - Intergenic
1005930621 6:30481449-30481471 CTCCTGGTGGGCGACCGTCATGG + Intergenic
1007679876 6:43626627-43626649 CCTCTGGTGATCCACCAGCATGG - Intronic
1010819436 6:80396061-80396083 CTCATGGAGAACCACTACCAGGG + Intergenic
1017358111 6:153534220-153534242 CTCTTGGTGCACCACCCTCCAGG + Intergenic
1018340942 6:162850639-162850661 CTCCAGGTGATCCACCCTCCAGG - Intronic
1020013463 7:4818398-4818420 CTCCTGGTGCTCCTCCTTCAGGG + Intronic
1021467687 7:20964237-20964259 TTCCTGATGAACCACCATTCTGG + Intergenic
1021725331 7:23543097-23543119 CTCCAGGTGCACCACCCTCCAGG - Intergenic
1021725399 7:23543644-23543666 CTCCAGGTGCACCACCCTCCAGG + Intergenic
1023834526 7:44060452-44060474 CGCCTGGTGAACCAGCATCCAGG - Intronic
1033524003 7:142192176-142192198 CCCCTGGTGTTCCACAATCAGGG + Intronic
1038762566 8:30397925-30397947 CTCCTGAAGAACCACCACCTAGG - Intronic
1044634825 8:94311830-94311852 CTCCAGGGGAAGCACAATCAAGG + Intergenic
1046551529 8:115723822-115723844 CTCCTGGTGAAATCCCACCAGGG - Intronic
1046747201 8:117888991-117889013 CTCCTGGTGAACCACCATCAGGG - Intronic
1048481280 8:134796044-134796066 CTCCAGGTGCACCACCCTCTGGG - Intergenic
1049066896 8:140323201-140323223 CTCCAGGTGTACCACCCTCCAGG - Intronic
1050833000 9:10037333-10037355 CTCCTGCTGCAACACCACCAAGG - Intronic
1051371430 9:16362526-16362548 CTTCTGGTGAACCGCCCTCAAGG - Intergenic
1052360227 9:27547592-27547614 TTCCTGGTGAACCACAGTTAGGG - Exonic
1052437915 9:28453761-28453783 CTCCTTGGCAACCACCTTCAGGG + Intronic
1053271521 9:36752703-36752725 CTCCTTGTAAATCTCCATCACGG - Intergenic
1059891793 9:118812322-118812344 CTCCAGGTGAGCCACCTTCCAGG + Intergenic
1060509595 9:124222319-124222341 CGTCTGGTGAGCCACCACCATGG - Intergenic
1187457793 X:19458163-19458185 CTCCTGGGGCAGCAGCATCAAGG - Intronic
1189015148 X:37089164-37089186 CTCCTGAAGAACCACCACCTAGG - Intergenic
1189464003 X:41264500-41264522 CTCCAGGTGTACCACCCTCCAGG - Intergenic
1197943053 X:131809804-131809826 CTACTGGAATACCACCATCAAGG + Intergenic
1200708880 Y:6466246-6466268 TTCATGGAGAACGACCATCATGG - Intergenic
1201025232 Y:9698463-9698485 TTCATGGAGAACGACCATCATGG + Intergenic