ID: 1046751156

View in Genome Browser
Species Human (GRCh38)
Location 8:117928146-117928168
Sequence GGCCAATGGACTCATTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046751151_1046751156 25 Left 1046751151 8:117928098-117928120 CCTTTATCATACATATCTTAGAC 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG No data
1046751150_1046751156 26 Left 1046751150 8:117928097-117928119 CCCTTTATCATACATATCTTAGA 0: 1
1: 0
2: 0
3: 31
4: 270
Right 1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG No data
1046751153_1046751156 3 Left 1046751153 8:117928120-117928142 CCTTTGGAGTTGATAGAGAACAT 0: 1
1: 0
2: 3
3: 8
4: 139
Right 1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046751156 Original CRISPR GGCCAATGGACTCATTTTGC AGG Intronic
No off target data available for this crispr