ID: 1046754544

View in Genome Browser
Species Human (GRCh38)
Location 8:117959673-117959695
Sequence CAATGCATTTAATATGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046754544_1046754545 22 Left 1046754544 8:117959673-117959695 CCAAGCTCATATTAAATGCATTG 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1046754545 8:117959718-117959740 TGCTCAAACCACAGTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046754544 Original CRISPR CAATGCATTTAATATGAGCT TGG (reversed) Intronic
906011113 1:42527377-42527399 CAATGTAGTTGATAAGAGCTAGG - Intronic
908614690 1:65906180-65906202 CAATTCATTTAATATTTGCTGGG - Intronic
908831926 1:68187702-68187724 CAATACATTTCAAATGAGTTTGG + Intronic
909568196 1:77079280-77079302 CAAGGCATTTAACAAGTGCTGGG - Intergenic
909711903 1:78660964-78660986 CAAAGCATTTAATTTGGGTTAGG - Intronic
909829245 1:80164894-80164916 CAATGAATTTAAAATAAGGTAGG + Intergenic
910418117 1:87023665-87023687 TCATGCACCTAATATGAGCTAGG - Intronic
910869521 1:91820058-91820080 GCAGGCATTTAATATGTGCTAGG - Intronic
910892844 1:92035580-92035602 CTAAGCATTTACTATGAGCCAGG + Intronic
911269985 1:95789391-95789413 AAATACATTTGATATGATCTGGG - Intergenic
911647410 1:100351826-100351848 CAATACATGTACTGTGAGCTAGG + Intronic
914387248 1:147181804-147181826 CCATGCATTTTAAATGAGGTGGG + Intronic
916193896 1:162205395-162205417 CAAAGCATTAAACATGAGCTTGG + Intronic
918126197 1:181586146-181586168 CGATGGATTGAATATGAGTTTGG + Intronic
919416978 1:197322904-197322926 TTATGCATCTAATATGTGCTAGG - Intronic
919797106 1:201327468-201327490 CACTGCATTGAAGATGGGCTTGG + Intronic
1062790633 10:302382-302404 CAATGAATTTAACAGGTGCTTGG - Intronic
1063512613 10:6660802-6660824 CTATGCATTTATTATGTGCCAGG - Intergenic
1063695567 10:8331804-8331826 CAATGCATTTCACATGACCAAGG - Intergenic
1064404768 10:15051935-15051957 CAATGCATACAAAATGAGCATGG + Intronic
1065690465 10:28327319-28327341 CAATGAATTTGAAACGAGCTAGG - Intronic
1066584512 10:36917911-36917933 CAAAGCATCTATTCTGAGCTTGG + Intergenic
1068511012 10:57965771-57965793 CAATATCTTTAATATCAGCTAGG + Intergenic
1068637628 10:59364630-59364652 CAATGCTTTTAATTTGAAATAGG + Intergenic
1069666121 10:70160928-70160950 CACTGCTTTTAAAAGGAGCTGGG + Intronic
1071451296 10:85793393-85793415 CAATGCATGTAAGAGGAGCTGGG - Intronic
1071866558 10:89740818-89740840 CAATAAATTTAAAAGGAGCTAGG - Intronic
1072848809 10:98863233-98863255 CAAAGCATTTAATAGAATCTAGG + Intronic
1076611849 10:131731005-131731027 CAAGGCATTTCCTATGTGCTAGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1081431028 11:42976894-42976916 CAATGTAGTTGATATGGGCTTGG - Intergenic
1083830237 11:65226940-65226962 AAATGGATTTAATAGGGGCTGGG + Intergenic
1087321487 11:96665043-96665065 TAATGCATTTAATTTGAACTTGG + Intergenic
1089377284 11:118003405-118003427 CAATGCATTTAATTTTAAATTGG - Intergenic
1098160640 12:67645790-67645812 CAAAGAATTTAGTATGTGCTAGG - Intergenic
1098477127 12:70918246-70918268 AAATGCATTTAAAATGAAATTGG + Intronic
1099109565 12:78541001-78541023 AAATGCATTTACTATGCTCTTGG - Intergenic
1100177976 12:92052242-92052264 CAATGACTTGAAGATGAGCTTGG - Intronic
1101914827 12:108887949-108887971 CAAAGCATTTATTATGTGCCAGG + Intronic
1102614400 12:114140491-114140513 CTATTCATTTAAGATGAACTTGG - Intergenic
1105488843 13:20866685-20866707 CCATGCTTTTAAAATGAGTTTGG - Intronic
1106059159 13:26269729-26269751 CACTGAATTTAAAATGTGCTTGG + Intronic
1106586081 13:31057260-31057282 CAAGGCATATTATATGTGCTTGG + Intergenic
1107191658 13:37595526-37595548 CAAGGCATTTAAGCTTAGCTGGG - Intronic
1108317567 13:49252167-49252189 CAATGCAGTGAATAGGAGCTGGG - Intronic
1110866725 13:80404800-80404822 CCATGCATTTGATATGATTTTGG + Intergenic
1113100162 13:106708903-106708925 CTATCGATTTAATAAGAGCTTGG - Intergenic
1114273202 14:21117433-21117455 AAATGTATTTAAAATTAGCTGGG + Intergenic
1114883918 14:26823711-26823733 CAATGCATTTAATCTTAACATGG + Intergenic
1116214205 14:41990088-41990110 AAATGTGTTTAATATGAGTTTGG - Intergenic
1116601127 14:46924868-46924890 CAAGCCATTTAATAAGAGTTTGG + Intronic
1116957065 14:50935666-50935688 CAGTCCAATTAATATCAGCTTGG - Intronic
1117275291 14:54187768-54187790 CATTTCAGTTAATTTGAGCTTGG + Intergenic
1119109220 14:71956022-71956044 CTATGTGTTAAATATGAGCTGGG + Intronic
1121295588 14:92819335-92819357 CCATGCAATTACTATGTGCTGGG - Intronic
1125248202 15:37667330-37667352 GAATACATTTAATATGTACTAGG + Intergenic
1125452942 15:39827759-39827781 ACATGCATTTAATATTAGATTGG - Intronic
1127046513 15:55031759-55031781 TTGTGCATTTACTATGAGCTAGG - Intergenic
1127726575 15:61756195-61756217 CAAATAATTTAATATGAGCCTGG + Intergenic
1135280768 16:21152387-21152409 CAATGCTTTTCATAGGAACTCGG - Intronic
1135602292 16:23793666-23793688 CACAGCATTTACTATGACCTTGG + Intergenic
1137482224 16:48861936-48861958 GCTTACATTTAATATGAGCTTGG - Intergenic
1138131897 16:54486942-54486964 CAAGGCATTTATTATAAGCCAGG + Intergenic
1138881753 16:61024698-61024720 CACTGAATTTAAAATGAGATTGG + Intergenic
1139847424 16:69930709-69930731 TAATACATTTAAAATTAGCTCGG + Intronic
1140678526 16:77360112-77360134 GCATGCATTTAATATTAGATGGG - Intronic
1141380054 16:83568112-83568134 GAATGCCTTTGAAATGAGCTTGG - Intronic
1143692689 17:8583440-8583462 AAATTCATTTAACATGAGCGTGG + Intronic
1144229719 17:13189428-13189450 CAAAGCATTTAATATTACATGGG - Intergenic
1147548770 17:41423161-41423183 CCATGCATTTACTATTAACTGGG - Intronic
1150359228 17:64516042-64516064 TTATGCATTTACTCTGAGCTAGG - Intronic
1153786983 18:8544053-8544075 CACTACATTTAATATGCACTGGG + Intergenic
1154015977 18:10617892-10617914 CAATGAAATTGAGATGAGCTTGG + Intergenic
1154189532 18:12217752-12217774 CAATGAAATTGAGATGAGCTTGG - Intergenic
1164066148 19:21719065-21719087 CAATGTATTTAGAATGGGCTGGG + Intergenic
925935041 2:8749245-8749267 AAATACATCTCATATGAGCTGGG - Intronic
926421109 2:12700366-12700388 CACTGCCTGTCATATGAGCTAGG + Intergenic
926460176 2:13119567-13119589 CAATACATTTAATATGTCCCTGG + Intergenic
927630619 2:24770972-24770994 CAATGCATTTTATAGGAATTAGG + Intergenic
931504985 2:62916023-62916045 CATTAAATTTAAAATGAGCTAGG + Intronic
935343613 2:102082550-102082572 CCATGCACTTAACATGAGGTAGG + Intronic
935420322 2:102861265-102861287 CAATGCATTTATTATGAAATTGG + Intergenic
935979172 2:108609621-108609643 TAATGTATTTCATATGATCTTGG + Intronic
937269390 2:120638502-120638524 CAGTGCACCTACTATGAGCTGGG + Intergenic
938826434 2:135010376-135010398 CAATGACTTTAAGATGTGCTTGG + Intronic
938991394 2:136633404-136633426 AAATGCATTTAAAATCAGATAGG + Intergenic
940155091 2:150647474-150647496 CAATGCCGTTAAGCTGAGCTAGG - Intergenic
941516635 2:166488323-166488345 CAATGCATTTAATATCATTTGGG - Intronic
941698567 2:168579341-168579363 TAATGTATTTAATATGGGTTGGG + Intronic
941791802 2:169559959-169559981 CAAAGCATTTATTATGCACTGGG - Intronic
943103653 2:183516273-183516295 CAATGCAAATAATCTGAGCATGG + Intergenic
943245190 2:185438586-185438608 CAATTCATTTTATATTAGGTTGG + Intergenic
943981292 2:194554651-194554673 CAAAGTATATAATAAGAGCTTGG + Intergenic
946266795 2:218551187-218551209 TAAAGCATTTAATATAAGCATGG - Intronic
948060243 2:235037869-235037891 CAAATTATTTAATATGAGATGGG - Intronic
1174784560 20:53420415-53420437 CAATGAATGTCTTATGAGCTTGG - Intronic
1174882870 20:54300098-54300120 CAAGGCAGTTGATATGTGCTAGG + Intergenic
1175645965 20:60671929-60671951 CAATGTACTTACTATGTGCTTGG - Intergenic
1178715354 21:34959453-34959475 CACTGCATTTATGATGTGCTAGG - Intronic
1181665964 22:24397391-24397413 CAGTGCATTTAGTCTGACCTGGG - Intronic
1183860961 22:40669590-40669612 CAATGGATGAACTATGAGCTAGG + Intergenic
949939297 3:9142523-9142545 CAAGACATGAAATATGAGCTTGG - Intronic
951875958 3:27425766-27425788 AGATGCATTTAATATTAGGTTGG - Intronic
959850398 3:111079897-111079919 CTCTGCTTTTAATATGAACTAGG - Intronic
960280267 3:115773629-115773651 CTATGCATATAATATTAGGTTGG - Intergenic
962670523 3:137701530-137701552 AAATGCATCTAATATGAAATGGG + Intergenic
967540818 3:190665616-190665638 AAATGCATGTAACAAGAGCTAGG - Intergenic
971172233 4:24245276-24245298 CAATGCTTTATTTATGAGCTTGG - Intergenic
971280237 4:25237255-25237277 CATAGCAGTTAATATGCGCTAGG + Intronic
971650239 4:29262405-29262427 CAACACATTAAATATGAGATAGG + Intergenic
974611685 4:64226714-64226736 CAATGACTTTATAATGAGCTGGG + Intergenic
977916568 4:102600734-102600756 AAATGCATTGAATCTGAGGTGGG - Intronic
984276476 4:177617229-177617251 AAATGCATTTAATCTGATCCTGG + Intergenic
985301737 4:188497155-188497177 CAAGGCATTTCATCTCAGCTTGG - Intergenic
988412605 5:30906566-30906588 AAATGCATTTAAAATATGCTTGG + Intergenic
990811027 5:59723763-59723785 AAATGCATTCAATATTAGTTTGG - Intronic
991016122 5:61934351-61934373 GCATGCATTTGAAATGAGCTGGG + Intergenic
991903969 5:71489001-71489023 AAATGCATTTAATACAGGCTGGG - Intronic
992392897 5:76345682-76345704 CAGAGCATTTAATATGAGCCAGG + Intronic
994510550 5:100697967-100697989 ATATGCATTTAATATGTGCAAGG + Intergenic
994612676 5:102064804-102064826 GAATGAATTTAATAAAAGCTGGG - Intergenic
995320927 5:110832731-110832753 AAATGTACTCAATATGAGCTAGG + Intergenic
998539597 5:142967927-142967949 CAATGCCTTTAATAGTAGCAAGG - Intronic
999060676 5:148631181-148631203 GAATACAGTGAATATGAGCTGGG - Intronic
999990635 5:157046899-157046921 CAATGCAAGTATTAAGAGCTGGG - Intronic
1000761967 5:165237266-165237288 AAATGAAGTGAATATGAGCTTGG - Intergenic
1000773793 5:165391135-165391157 CAATGCATGTAACATTATCTAGG + Intergenic
1001345436 5:170892442-170892464 CAATGACTTGAATAAGAGCTTGG - Exonic
1002579623 5:180199823-180199845 CAAGAAATTTAATATGAGCCAGG - Intronic
1003679498 6:8237819-8237841 CATTGCTATTTATATGAGCTGGG + Intergenic
1004316702 6:14594442-14594464 CAATGCATTTAATACCAGATGGG - Intergenic
1005064671 6:21806685-21806707 CAAGGCAATTAATGTGAGTTAGG + Intergenic
1005193062 6:23249637-23249659 TAATTCATTTAATATGAATTAGG - Intergenic
1006657682 6:35610148-35610170 TTAAGCATTTACTATGAGCTGGG + Intronic
1012085263 6:94817356-94817378 AAATGCATTTAATCTGTGATTGG + Intergenic
1012263775 6:97117084-97117106 CAATTGATTTATTATAAGCTGGG - Intronic
1012340664 6:98118784-98118806 CAGTACAATTAATTTGAGCTTGG + Intergenic
1014255775 6:119159057-119159079 CAATGTGTTTTAAATGAGCTGGG - Intergenic
1015325896 6:131923011-131923033 CAATGCATTTAAAATAATGTTGG + Intergenic
1015554294 6:134444881-134444903 CTATGAATTTAATGTCAGCTAGG - Intergenic
1015630713 6:135229284-135229306 CAAAGGACTTACTATGAGCTAGG - Intergenic
1017568328 6:155713014-155713036 CAATGAATTTAATTTCACCTGGG + Intergenic
1020679207 7:11216042-11216064 ATATGCATTTAAAATGAGCTGGG + Intergenic
1022851783 7:34270775-34270797 CAATGCATTTAATATGCAAATGG + Intergenic
1023338965 7:39199113-39199135 CAATGCATTTTTTATGAATTGGG - Intronic
1023482849 7:40653221-40653243 AAATGCATTTAATATATGCCAGG - Intronic
1024387160 7:48765617-48765639 AAATGCATTTACTCTGAGCAGGG - Intergenic
1026152027 7:67796017-67796039 CAAAGCATTCAATATGATTTTGG + Intergenic
1027552073 7:79611241-79611263 TAATGCAGTGAATGTGAGCTTGG + Intergenic
1030178393 7:106678626-106678648 GAATGCTTTTACTATGAGCAAGG - Intergenic
1030900464 7:115117248-115117270 CAATGCAGTTGATGTGAGCATGG + Intergenic
1031792636 7:126128148-126128170 AAATACATTTTATATCAGCTGGG - Intergenic
1032499182 7:132387004-132387026 AAATGCATTGAGTATGTGCTGGG + Intronic
1033612302 7:142975484-142975506 CAATGCATTTAAGATAAAGTAGG + Intergenic
1036703327 8:11028723-11028745 GCAAGCACTTAATATGAGCTGGG + Intronic
1037454366 8:19048712-19048734 CAATGGATTCTATATGAGCAGGG + Intronic
1037913890 8:22760452-22760474 CAATGCATATAGTAGGTGCTTGG + Intronic
1038810897 8:30841474-30841496 TAAAGCATTTAATATGTACTTGG - Intronic
1040685467 8:49867024-49867046 CTATTCAATTAATATGAGATAGG + Intergenic
1040911256 8:52521461-52521483 CAATGCATTTTATATTGTCTTGG - Intergenic
1041840960 8:62270375-62270397 CAAAGCCTATAATATGGGCTGGG - Intronic
1045271106 8:100662390-100662412 CATTGCAGTTATTAAGAGCTTGG - Intronic
1045808382 8:106192177-106192199 CAGTGCAGTTAATAAGAGATAGG - Intergenic
1046754544 8:117959673-117959695 CAATGCATTTAATATGAGCTTGG - Intronic
1048012683 8:130470826-130470848 CTAAGCATTTACCATGAGCTAGG - Intergenic
1048397850 8:134031721-134031743 GAAAAAATTTAATATGAGCTGGG - Intergenic
1054841235 9:69743041-69743063 CATGACATTTAATAAGAGCTTGG - Intronic
1055090565 9:72361577-72361599 TAATACATTGAATTTGAGCTTGG - Intronic
1056036915 9:82616428-82616450 CAATTCATCAAGTATGAGCTAGG + Intergenic
1056484413 9:87041084-87041106 GAATGCGTTAAATATGAGCTAGG - Intergenic
1058761433 9:108137345-108137367 TAGTGCATTTACTATGAGCTGGG + Intergenic
1186098458 X:6128943-6128965 AAATGCCTGAAATATGAGCTGGG - Intronic
1187759417 X:22563973-22563995 CAGAGCATTTAATATGATATAGG - Intergenic
1187962472 X:24579749-24579771 CTTTGCAGTTAATATGAGCAGGG - Intronic
1188174516 X:26973067-26973089 CTGTGCATTTAATTTGTGCTAGG - Intergenic
1188302891 X:28527347-28527369 AAATGAATTTAATCAGAGCTGGG + Intergenic
1188318674 X:28708329-28708351 CAATGCCTTTAACATGTCCTTGG + Intronic
1188324440 X:28783620-28783642 CAATCTATTCAATATGAGTTGGG - Intronic
1188777920 X:34244865-34244887 CTGTGCAATTAATATGAACTAGG + Intergenic
1189084729 X:38010220-38010242 CAGAGCACTTACTATGAGCTAGG - Intronic
1193515540 X:82457563-82457585 CATTGCATTTAATATGATTTTGG + Intergenic
1194145951 X:90263189-90263211 CAAAGAATTTAATAAGAGATTGG + Intergenic
1196206725 X:112948144-112948166 GAATGCATGTAAGATGACCTGGG - Intergenic
1200491696 Y:3832481-3832503 CAAAGAATTTAATAAGAGATTGG + Intergenic
1200988829 Y:9329540-9329562 TAATACATTTAATATGAACTTGG + Intergenic
1202106443 Y:21373012-21373034 CATTGATTTTAATATGAACTTGG + Intergenic