ID: 1046754749

View in Genome Browser
Species Human (GRCh38)
Location 8:117961871-117961893
Sequence CCTTTCAACTATGAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046754749 Original CRISPR CCTTTCAACTATGAGATCTG TGG (reversed) Intronic
900337215 1:2170209-2170231 CCTTTCATCTCTGATATCTTCGG + Intronic
902793006 1:18781874-18781896 ACTTACAGCTATGGGATCTGGGG - Intergenic
905035620 1:34916376-34916398 CCTTTCAACTCTGAAGTCTAAGG + Intronic
905536243 1:38724172-38724194 CCTTAAACCCATGAGATCTGAGG - Intergenic
906591169 1:47025187-47025209 CTTTTCAACAATCAGTTCTGGGG - Intronic
911067496 1:93803651-93803673 CCTGCCAACTATGCCATCTGTGG + Intronic
911310975 1:96291683-96291705 CATTTGAAATCTGAGATCTGAGG + Intergenic
912123876 1:106508514-106508536 ACTTTTAACTCTGAGTTCTGGGG - Intergenic
913076211 1:115342551-115342573 CCTTTCAAGAATGGGATCTGTGG - Intergenic
914322581 1:146579406-146579428 TCTTTCAGCTATGTGATCTGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
920313658 1:205062865-205062887 CCTTTCAGCTATGTGAGCTTTGG + Intronic
920441912 1:205986404-205986426 TCTCTCAGCTATGTGATCTGGGG - Intronic
921310088 1:213833889-213833911 CCTTTCAAAGATAAGTTCTGTGG - Intergenic
922669160 1:227495553-227495575 CTTTTCTATTAGGAGATCTGTGG + Intergenic
922670436 1:227505749-227505771 CCTTTCTATTAGGAGATCTGTGG - Intergenic
1063879021 10:10511663-10511685 CACTTCTACTATGAGATCTCGGG + Intergenic
1065274684 10:24073939-24073961 TCTTTCAACTCTCCGATCTGGGG + Intronic
1070548509 10:77472745-77472767 TCTTTCATCTGTGACATCTGTGG + Intronic
1071369721 10:84939021-84939043 CCTCTCAATTATGAGTCCTGGGG + Intergenic
1071821018 10:89280933-89280955 CTTTTCACCTATAATATCTGAGG - Intronic
1072536580 10:96368899-96368921 CTTTCAAACTATGAGGTCTGTGG - Intronic
1072975021 10:100049946-100049968 CCTTTCAAATATCAAAACTGTGG - Intronic
1073094262 10:100970145-100970167 CCTTTCCTCTATTAGATCTTGGG - Intronic
1073235796 10:102014835-102014857 CCTTACACCTATGGGATGTGAGG + Intronic
1073561693 10:104502498-104502520 CTTGTCAACTCTGTGATCTGTGG + Intergenic
1074266192 10:111905954-111905976 CTTTTAAACTATCAGATCTCAGG + Intergenic
1076277775 10:129218917-129218939 CTTTTCAACTCTGAGATTTGGGG + Intergenic
1076715401 10:132361479-132361501 CCTGTTATCTATCAGATCTGTGG - Exonic
1079639359 11:22784862-22784884 GCTTTTAACTATAAGATCTGAGG + Intronic
1081014824 11:37863755-37863777 CCTTTCATCTCTAAGATATGTGG - Intergenic
1084793651 11:71490458-71490480 CCTGTCAACTCTGAGGCCTGTGG - Intronic
1085652580 11:78281568-78281590 TCTTTAACCTATGATATCTGAGG - Intronic
1087305433 11:96484294-96484316 CTTTTCAACTTTGACATCTGCGG + Intronic
1088316261 11:108509838-108509860 CCTATCGACTATGGGATCTTTGG - Exonic
1089670396 11:120052801-120052823 CCTATCAAATATAAGATATGTGG - Intergenic
1090886279 11:130879695-130879717 AATTTCTACTACGAGATCTGAGG + Exonic
1091855924 12:3740123-3740145 CCTTTCAACTAGGAGATCCCTGG + Intronic
1092749333 12:11703813-11703835 CCTTTCAATTTTAAGATTTGAGG + Intronic
1095643182 12:44508785-44508807 ACTTTCAATTATGAAATTTGTGG - Exonic
1098111215 12:67123755-67123777 CCTTTCAACTCTGAGATTCTAGG + Intergenic
1099788359 12:87297021-87297043 CCTATCATCTATGACATTTGGGG + Intergenic
1100392392 12:94155217-94155239 CCTTTCAACTATGAGAGGAAAGG + Intronic
1100607456 12:96163338-96163360 CCTCTCAGAAATGAGATCTGTGG - Intergenic
1100738481 12:97564481-97564503 CGCTTCAACTATGTGACCTGGGG + Intergenic
1101838701 12:108312637-108312659 CCTTCCTACTGTGAGATCTTGGG - Intronic
1103024273 12:117560796-117560818 CCTTTAAACTATCAGATCTCAGG - Intronic
1107339858 13:39394439-39394461 CCTTTCAACTATTACATTTGAGG - Intronic
1108405482 13:50096566-50096588 CCTTTTAATTCTGAGAACTGGGG - Intronic
1108771717 13:53710235-53710257 ACTTTCTAAAATGAGATCTGGGG + Intergenic
1110003598 13:70237334-70237356 CATTTCAATTATCAGATCTCTGG + Intergenic
1113673331 13:112190045-112190067 CCTTTAAACAAGGAGATCTCAGG - Intergenic
1114497882 14:23146472-23146494 CCTTCAAACTATCAGCTCTGTGG + Intronic
1114581564 14:23765084-23765106 CCTCCCAAATATTAGATCTGAGG + Intergenic
1117974674 14:61285735-61285757 CATTACAACTATGAGAACTCAGG - Intronic
1118794131 14:69124593-69124615 TATTTCAACTATGAGTTCTCTGG + Intronic
1119127074 14:72137426-72137448 CCCTTTACCTGTGAGATCTGAGG - Intronic
1123966698 15:25466762-25466784 CCATTGAACTATGAGCTCTTTGG - Intergenic
1124273771 15:28308002-28308024 CTTTTCAATTATGAGAGCTTCGG + Intronic
1124309037 15:28605013-28605035 CTTTTCAATTATGAGAGCTTCGG - Intergenic
1125226163 15:37398685-37398707 CCATTCAACTGTGTGATCTTAGG - Intergenic
1126241747 15:46452906-46452928 CCTTTCCACTATGACATCTTGGG + Intergenic
1126990420 15:54368878-54368900 CCTTTCAAATATTAAAGCTGAGG + Intronic
1128034688 15:64514453-64514475 CAATTCAACGATAAGATCTGAGG - Intronic
1129716623 15:77855828-77855850 CATTTCAACTCTAAGTTCTGGGG - Intergenic
1132013173 15:98293449-98293471 CCTTTCACCTAAGAGAACTGGGG - Intergenic
1132487484 16:202275-202297 CCTTTAAACAATCAGCTCTGAGG + Intronic
1133562148 16:6960276-6960298 CTTCTCATCTATAAGATCTGAGG - Intronic
1134611906 16:15615774-15615796 CCTGTCCACTATGAGACCAGAGG - Intronic
1139162607 16:64529105-64529127 CCTATTAACTGTGAGATCTGGGG + Intergenic
1139166280 16:64568283-64568305 CCTTTCAGCTGGGACATCTGTGG + Intergenic
1139758599 16:69165885-69165907 GCTTTCAACTTTGAACTCTGGGG + Intronic
1140011043 16:71131769-71131791 TCTTTCAGCTATGTGATCTGGGG - Intronic
1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG + Intronic
1144668580 17:17118576-17118598 CCTTTGAACCATGAGGACTGTGG + Intronic
1149347417 17:55752060-55752082 GCTTTCACCTATGAAACCTGGGG - Intronic
1150668034 17:67163270-67163292 CCTTTCATCTTTCAAATCTGAGG + Intronic
1152483958 17:80577328-80577350 CCTTTCAAGAATGACAACTGAGG - Intronic
1154073891 18:11180043-11180065 CCTTGCAACTATGAGCTTTAAGG - Intergenic
1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG + Intergenic
1158304377 18:56088633-56088655 CCTTTGAACTACCAGATCTCCGG + Intergenic
1159006657 18:63019500-63019522 CCTTTTAACTGTGAGATAGGAGG - Intergenic
1160616299 18:80132184-80132206 CCCTTTAAGTATGAAATCTGAGG - Intronic
1161244472 19:3241689-3241711 CATTTCAACTGTGAGAGCTCTGG - Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1163298581 19:16428936-16428958 ACTGTCAACTACCAGATCTGTGG + Intronic
1164418328 19:28064922-28064944 CTTTTCAACAATGAGATCAAAGG - Intergenic
1165008781 19:32828044-32828066 CCTTTCAACCATGAGATAGTGGG + Intronic
1166587895 19:43967432-43967454 CCATTCAAATATGAGAACTGTGG + Exonic
1166607513 19:44157967-44157989 CCTTACAAATGTGAGATATGTGG + Exonic
1167260937 19:48457289-48457311 CCTTTCACAGATGAGAGCTGAGG + Intronic
925674185 2:6342847-6342869 CCTTTAAAGTTTTAGATCTGTGG - Intergenic
925950941 2:8910677-8910699 CCTTTCTACTTTGAGAGTTGGGG - Intronic
925962791 2:9034069-9034091 ACTCTTAAATATGAGATCTGAGG + Intergenic
926329988 2:11816565-11816587 CATATCAACTATGAGATTTAGGG - Intronic
927187790 2:20494665-20494687 TCTTTCAACTCTGTGATTTGGGG - Intergenic
927406449 2:22775029-22775051 CCTTTGAAATGTGAGATTTGGGG + Intergenic
927649850 2:24905846-24905868 CTTACCAACTGTGAGATCTGGGG - Intronic
928449841 2:31368394-31368416 CCTTTCAACCCTGGGATTTGGGG - Intronic
931128799 2:59308157-59308179 CCTAATAACTATGAGATCTTGGG - Intergenic
936657654 2:114506538-114506560 CCTTTCAACTTTGCCATCTGTGG - Intronic
936993487 2:118389805-118389827 CCTTTCAGCTGTGAGATCTCAGG + Intergenic
937425957 2:121798571-121798593 CATTGCAACCATGAGCTCTGGGG - Intergenic
938314537 2:130316837-130316859 CCTTTGAACTCTGAGATGGGGGG - Intergenic
941361969 2:164562511-164562533 ACTTTCTACTATGAAATCTTTGG + Intronic
941893202 2:170603521-170603543 TCCTTCATCTATGAAATCTGGGG - Intronic
944868125 2:203882104-203882126 ACTTACTACGATGAGATCTGGGG - Intergenic
946405095 2:219488289-219488311 CCTTTCATCCAGGAGATGTGCGG - Exonic
946664315 2:222033120-222033142 CATTTTAACTCTGAGCTCTGAGG - Intergenic
946891928 2:224285561-224285583 CCTCTCCACAATGATATCTGAGG + Intergenic
947443781 2:230147524-230147546 GCCTTTAACTAGGAGATCTGTGG - Intergenic
947505656 2:230706525-230706547 CCTTATAACCCTGAGATCTGTGG + Intergenic
1170283027 20:14672741-14672763 CCTTTTAATTACCAGATCTGTGG + Intronic
1170705506 20:18741305-18741327 CTTCTCAACTGTGAGCTCTGTGG - Intronic
1172103181 20:32498007-32498029 CCTTTCAACTTTATTATCTGGGG - Intronic
1172612869 20:36264792-36264814 CCTTTCAGCTTTGACATCTTAGG - Intronic
1173655213 20:44695565-44695587 CCTTTCAGGTTTGAAATCTGTGG + Intergenic
1174296384 20:49548241-49548263 CTTCTCAGCTATGAGATCTTGGG - Intronic
1174564123 20:51452445-51452467 GCTGTCAGCAATGAGATCTGAGG - Intronic
1174731597 20:52923397-52923419 CCTTTCTATTGTGAGAGCTGGGG + Intergenic
1174927767 20:54779327-54779349 CCTTTCAAATATCTGATCTTGGG - Intergenic
1178718243 21:34986306-34986328 CCTTTCAACTTTCAGGTTTGAGG - Intronic
1179295967 21:40062827-40062849 TCTTTCAAACATGATATCTGGGG + Intronic
1180501761 22:15936138-15936160 CCTTTCCACTATGAGCTCCTGGG - Intergenic
1180705730 22:17808700-17808722 CCCTTCATCTCTGAGATTTGGGG - Intronic
950861374 3:16150361-16150383 CCTTTCAAATATCTGAACTGGGG - Intergenic
953233533 3:41085674-41085696 CCTTCCATCTGTGACATCTGAGG + Intergenic
953235318 3:41101555-41101577 CCATTCAACTATGGTATCTTAGG - Intergenic
955110076 3:55940232-55940254 CCTTTCAACTCTGAAATCCTGGG - Intronic
959765239 3:110018969-110018991 CCTTTCAAGTATGAAATATGGGG - Intergenic
962376223 3:134860896-134860918 ACTTTCACCTATTAAATCTGGGG - Intronic
965681946 3:171260576-171260598 TCTTTGTACTATGAGTTCTGTGG + Intronic
966399399 3:179533004-179533026 GATTTCAACTATGTGATCTCTGG - Intergenic
967050439 3:185778514-185778536 CCTTTTAACTAGGTGATCTTGGG - Intronic
967557074 3:190872652-190872674 CATTTTAAATATGAGATCTTGGG + Intronic
967603403 3:191415589-191415611 CTTTTCAACGACCAGATCTGGGG + Intergenic
975901894 4:79163381-79163403 CCTTTCTTCCATGAGAACTGTGG + Intergenic
976946954 4:90782421-90782443 CCTATTAACGATAAGATCTGAGG - Intronic
980214604 4:129835387-129835409 CCTTTTAAGTCTGAGATCTGGGG + Intergenic
983724310 4:170901368-170901390 CTTTCAAACTATGAGACCTGGGG - Intergenic
986344972 5:6826546-6826568 CACTTCAATGATGAGATCTGTGG - Intergenic
988346673 5:30045692-30045714 TCTATCAACTATGAGAACAGGGG + Intergenic
990147301 5:52776341-52776363 CCTTTGCACTTTGAGGTCTGGGG + Intergenic
991428565 5:66518373-66518395 TCTATCAACTGAGAGATCTGGGG - Intergenic
993274833 5:85843833-85843855 CCTTTCAGCTCTGCCATCTGCGG + Intergenic
994318851 5:98366063-98366085 CCTTGCCACTATGAGATGGGAGG + Intergenic
994584933 5:101694931-101694953 CCTTAGAAATATGAGACCTGGGG - Intergenic
996338573 5:122411611-122411633 CCCTTCAACTATGAGATTCTAGG - Intronic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
998207580 5:140169686-140169708 ACTTTCAACTGTGGGATTTGGGG + Intergenic
998991790 5:147825101-147825123 CCTTTCATCTTAGAGCTCTGGGG + Intronic
1002919842 6:1559959-1559981 CCTGTGAACTATGTGATCTTGGG + Intergenic
1004051382 6:12083447-12083469 CCTGGCAACTATGTGCTCTGTGG + Intronic
1006467706 6:34206032-34206054 CCTTGCAACTCTGAGCCCTGTGG + Intergenic
1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG + Intergenic
1008671294 6:53771956-53771978 CTTTTCAACAATCAGTTCTGTGG + Intergenic
1010233853 6:73558842-73558864 CCTTTCAACCTTGAAATATGAGG + Intergenic
1011223521 6:85082976-85082998 CCTTTCAGCTATGAAAAATGGGG - Intergenic
1013727705 6:113120059-113120081 CCTTCTAGCTATGAGATCTTGGG + Intergenic
1014419844 6:121229905-121229927 CATTTAAACCATGAGATCTCAGG - Intronic
1014696147 6:124623490-124623512 CCCTACAACTTTAAGATCTGTGG - Intronic
1015891895 6:137977745-137977767 CTTTTTAACTCTGAGTTCTGTGG + Intergenic
1017782539 6:157727376-157727398 CGTTTCAACTAGAAGATCAGAGG + Intronic
1020383093 7:7567135-7567157 CCTTTCAACTAGGCTATCTCCGG - Intronic
1020458472 7:8401407-8401429 CCTATCAACGATGAGAGCTGTGG + Intergenic
1022280150 7:28900029-28900051 GCTTTCAACGATGACTTCTGGGG - Intergenic
1023626697 7:42121903-42121925 CCTTTTAATTTTAAGATCTGGGG - Intronic
1023730239 7:43184920-43184942 CCCTTAAACAATGAGATCTCAGG + Intronic
1026061872 7:67033671-67033693 TCTTTCATCTCTGTGATCTGGGG + Intronic
1026716478 7:72793777-72793799 TCTTTCATCTCTGTGATCTGCGG - Intronic
1027815296 7:82960996-82961018 CCTTCCAGCTATGTGATCTTGGG + Intronic
1028169034 7:87573572-87573594 GCTTTCAAATATAAAATCTGGGG - Intronic
1030503208 7:110386001-110386023 CCTTTCCCTTCTGAGATCTGTGG + Intergenic
1031256123 7:119450755-119450777 CCTATCAACTCAGATATCTGTGG + Intergenic
1032016032 7:128380956-128380978 CCTGTCTCCTCTGAGATCTGAGG + Intergenic
1038932945 8:32215583-32215605 CCTTACAACTGTGAGACCTTGGG - Intronic
1039406665 8:37318812-37318834 CCATTCAACTATCAGACTTGAGG - Intergenic
1041479985 8:58309097-58309119 CCTTTCAAGTATGAAATATGCGG + Intergenic
1042346128 8:67730106-67730128 CCACTAACCTATGAGATCTGGGG - Intronic
1043098582 8:76009614-76009636 CTTTGTAACTATGAGAGCTGAGG + Intergenic
1045437278 8:102175987-102176009 CCTTTCAACAATGAGAAATATGG - Intergenic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1047926862 8:129690735-129690757 CCTATCAGCTATGTGATCTTGGG - Intergenic
1048783815 8:138029512-138029534 TCTTTCAACTATTTGAACTGGGG + Intergenic
1049261834 8:141643375-141643397 CCTGTGAACTAGGAGATCTGAGG - Intergenic
1049304420 8:141893333-141893355 CCTTACACTTAAGAGATCTGAGG + Intergenic
1049328296 8:142035631-142035653 CCTTTGACCTTTGACATCTGGGG - Intergenic
1049513765 8:143042991-143043013 CTTTTCAGCCATGAGATCAGGGG - Exonic
1050341072 9:4638991-4639013 CTTACCAACTATGTGATCTGGGG + Intronic
1050803752 9:9647906-9647928 CAATTAAAGTATGAGATCTGGGG - Intronic
1050891062 9:10825164-10825186 CATTTCCACTATGATCTCTGTGG - Intergenic
1051054237 9:12964963-12964985 CCTTTCATCTATGTGACCTCAGG + Intergenic
1053141817 9:35687416-35687438 CCTTTCCACTCTGAAATCTCAGG - Intronic
1053589844 9:39500877-39500899 CCTTTCAAATATATGAACTGTGG + Intergenic
1054576455 9:66864429-66864451 CCTTTCAAATATATGAACTGTGG - Intronic
1055725574 9:79224621-79224643 CCTTGCAACCATCAGTTCTGGGG + Intergenic
1056961688 9:91130249-91130271 CCATTAACCTAAGAGATCTGAGG - Intergenic
1059590858 9:115659964-115659986 CCTTTCAACTCTGACATTTGGGG + Intergenic
1060012049 9:120052417-120052439 CCTTTCAGTTATGACATCTCTGG - Intergenic
1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG + Exonic
1186532787 X:10314174-10314196 CATTTCAACTACAAGAACTGAGG - Intergenic
1186974828 X:14890763-14890785 CCTTTCAGCTATTATCTCTGAGG + Intronic
1187050505 X:15691271-15691293 CTTTTCAACAATCAGTTCTGTGG + Intronic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1193329369 X:80218446-80218468 CCTTTAAACAATGAGATCTTGGG - Intergenic
1193795516 X:85868277-85868299 ACTTTCAGCTATAAGTTCTGGGG + Intronic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1195651386 X:107288691-107288713 CACTTCAACTATGAAATCTAGGG + Intergenic
1195918556 X:109959551-109959573 CTTATTAACTATGGGATCTGTGG + Intergenic
1195924812 X:110014864-110014886 CCTTTCACCCAGGAGCTCTGGGG - Intronic
1198436479 X:136621670-136621692 CCTTTGAACTTTCAGAGCTGTGG - Intergenic
1199388461 X:147250861-147250883 CCTGTTAACTATTAGACCTGAGG - Intergenic
1200395972 X:155988061-155988083 CTTTTAAACTATTAGATCTCAGG - Intergenic
1200985035 Y:9295078-9295100 CCTTTCAACTCTGAGGTCTTAGG - Intergenic