ID: 1046759310

View in Genome Browser
Species Human (GRCh38)
Location 8:118004759-118004781
Sequence TATTACATGGAGAATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046759310_1046759316 21 Left 1046759310 8:118004759-118004781 CCACCCACATTCTCCATGTAATA 0: 1
1: 0
2: 1
3: 24
4: 164
Right 1046759316 8:118004803-118004825 CCAAATATGCTGATGATTCTAGG No data
1046759310_1046759314 -5 Left 1046759310 8:118004759-118004781 CCACCCACATTCTCCATGTAATA 0: 1
1: 0
2: 1
3: 24
4: 164
Right 1046759314 8:118004777-118004799 TAATATGCAAACTGCGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046759310 Original CRISPR TATTACATGGAGAATGTGGG TGG (reversed) Intronic
905787131 1:40767244-40767266 TATTACTTGCAGAAGATGGGGGG + Intronic
906465363 1:46073967-46073989 TATTAAATGCAGAATGTGTTTGG + Intronic
908795262 1:67824873-67824895 TATTACCTGCTGGATGTGGGTGG + Intronic
910608197 1:89110501-89110523 TATTCCATGGTGTGTGTGGGGGG - Intronic
912528431 1:110302682-110302704 TGTGGGATGGAGAATGTGGGAGG + Intergenic
916570613 1:166023176-166023198 TGTTACATTGGGAATGTGGTGGG - Intergenic
916974949 1:170066179-170066201 TATAACATAAAGAATGGGGGGGG - Intronic
918696200 1:187549534-187549556 CATTACCTGGACAATGTGGCTGG - Intergenic
921261460 1:213388469-213388491 AATTGCATGAAGAATGTGGGAGG - Intergenic
922645612 1:227283706-227283728 TATTACATGCATAATGGTGGGGG - Intronic
1063915821 10:10880990-10881012 TGTGACATGAAGAAGGTGGGTGG - Intergenic
1067052902 10:43034489-43034511 TAATTCTTGGAGAAGGTGGGGGG - Intergenic
1070771852 10:79087214-79087236 TAATACATGTATAATGTGAGGGG - Intronic
1072622844 10:97091551-97091573 TGTTTCAAGGAGAATTTGGGGGG - Intronic
1073677818 10:105668934-105668956 TATTTGATGAAGAATGTGGTGGG + Intergenic
1076900883 10:133336797-133336819 CATTTCTTGCAGAATGTGGGCGG - Intronic
1077276059 11:1709142-1709164 CAATTCATGGAGCATGTGGGTGG + Intergenic
1079318495 11:19430287-19430309 TCTTCCATGGAGTATGTGGCAGG + Intronic
1083076400 11:60043237-60043259 AATTTCATGGAGGAGGTGGGAGG - Intronic
1084848201 11:71917518-71917540 TATTAGGTGTAGACTGTGGGAGG - Intronic
1085491196 11:76919480-76919502 TATTATAAGGAGAATGTGTTTGG + Intronic
1086614633 11:88801640-88801662 TATTAAGAGGACAATGTGGGAGG + Intronic
1086808476 11:91273507-91273529 TGTTACATGGAGAAAGAGGGAGG - Intergenic
1088028931 11:105222496-105222518 TATTACACTGAGAATGGGGGAGG - Intergenic
1088174769 11:107039984-107040006 TATTACAGGGTGAGAGTGGGAGG + Intergenic
1089061464 11:115629505-115629527 TGCTACATGGAGAAATTGGGTGG - Intergenic
1089500928 11:118930730-118930752 TATTAGATGGAGACCCTGGGAGG - Intronic
1092276822 12:7067747-7067769 TACTACATGGAAAATGGAGGAGG + Exonic
1093591473 12:20907110-20907132 CATTACATGAAAAATGTGTGCGG + Intronic
1093868062 12:24252369-24252391 TTTTACATAGAGAATGTGTTTGG + Intergenic
1095400117 12:41804659-41804681 GATTACCTGGAGTATGTGAGTGG - Intergenic
1095715559 12:45342564-45342586 AAGTACATGGAAAATTTGGGGGG + Intronic
1099879036 12:88443991-88444013 TGATACATGGAAACTGTGGGGGG + Intergenic
1100286866 12:93174952-93174974 TATTTCCAGGAGAAGGTGGGTGG - Intergenic
1101558471 12:105832979-105833001 TATTCCATGGGCACTGTGGGAGG - Intergenic
1107731871 13:43356866-43356888 TATTACATGAACAATTTGTGTGG - Intronic
1114250633 14:20957179-20957201 TATCACATGGAGGATGATGGGGG - Intergenic
1116014712 14:39392495-39392517 TGGTACATGGAGAATATGGATGG + Intergenic
1116609187 14:47045609-47045631 TATTAGATTGAGAATGTTGGAGG + Intronic
1116838266 14:49792506-49792528 TATAAAATGGAGATTGTGGCTGG - Intronic
1117860833 14:60091388-60091410 TATTTCGTGGAGAATGGGGGAGG + Intergenic
1120860571 14:89251548-89251570 TATTTAATGTGGAATGTGGGTGG + Intronic
1121989930 14:98547019-98547041 TAGTAGATTGAGGATGTGGGTGG + Intergenic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1127232147 15:57008347-57008369 TTTTACATGGCTAATGTGAGTGG - Intronic
1128733265 15:70034939-70034961 TATAACAAGGAGACTCTGGGTGG - Intergenic
1130373044 15:83303646-83303668 TATTCCTTGGTGACTGTGGGAGG - Intergenic
1131324839 15:91432235-91432257 TCTTCCCTGGAGAAGGTGGGTGG + Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1134619948 16:15680277-15680299 TACTATATTCAGAATGTGGGGGG + Intronic
1135575077 16:23579522-23579544 TATTCCATGGAGAGTGTGTGTGG - Intergenic
1135844212 16:25903778-25903800 TATTGTTTAGAGAATGTGGGAGG - Intronic
1139170564 16:64626006-64626028 TATTCCATGGAAAGGGTGGGTGG - Intergenic
1142275566 16:89117018-89117040 TATTACGTGGTGACTGTGGCCGG - Intronic
1142417821 16:89952666-89952688 TATTACCTGATGACTGTGGGTGG - Intronic
1144504286 17:15817115-15817137 TATCACATGCACAATGGGGGGGG - Intergenic
1145168142 17:20632624-20632646 TATCACATGCACAATGGGGGGGG - Intergenic
1145850018 17:28084128-28084150 TATTAAATGCAGAATTTAGGAGG - Intronic
1146127990 17:30244110-30244132 TATTTGATGGAGAGTATGGGAGG - Intergenic
1146643904 17:34563653-34563675 AATTACATGGGGAATGTGGGAGG - Intergenic
1148529466 17:48375630-48375652 TATTACATGGAGGAAGTATGGGG - Intronic
1149624541 17:58070990-58071012 TATTACTTGGGGTCTGTGGGAGG - Intergenic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1153991098 18:10401480-10401502 GAGTAGATGGAGAATGTGGTAGG + Intergenic
1159015433 18:63098625-63098647 AATGGCATGGAGAATGGGGGAGG - Intergenic
1163436535 19:17299237-17299259 AATTATATAGAGAATGGGGGGGG - Intronic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
929948093 2:46385665-46385687 TAGTACATAGAGAATGTGAGGGG - Exonic
930231272 2:48846316-48846338 TATTTCATGGAGCAGGTGGAAGG + Intergenic
930607248 2:53505330-53505352 TATAACTGGGAGAATGGGGGTGG - Intergenic
931928478 2:67101293-67101315 TTATACATTGAGAATGTGTGTGG - Intergenic
933159305 2:79006889-79006911 TATTAAATGAAGAGTGTGGTTGG + Intergenic
935436621 2:103042461-103042483 AATTCCATGAAGAATGTTGGCGG - Intergenic
937147971 2:119663612-119663634 TATAAAATGGAGAAATTGGGCGG + Intergenic
937936319 2:127248412-127248434 GATCAGATGGAGAAAGTGGGAGG + Intergenic
938374902 2:130798717-130798739 TATCACATGTGGAAGGTGGGTGG - Intergenic
939632514 2:144542467-144542489 TATGACATGGAGAAGTTGAGAGG - Intergenic
941635292 2:167929402-167929424 TATTAGCTGCAGAATGTGTGTGG - Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
945326878 2:208492416-208492438 TTTTAAAGGGAGAATGAGGGAGG + Intronic
946085603 2:217168277-217168299 TATTACATTGAGACTGAGGTGGG + Intergenic
946088539 2:217198634-217198656 AATTAGAAGGTGAATGTGGGGGG - Intergenic
946607634 2:221423093-221423115 TAATACTTGGACAATGTTGGAGG + Intronic
947794369 2:232884952-232884974 GTTTACATGGAGGATGTGGGGGG - Intronic
948619299 2:239224090-239224112 GAATTCATGGGGAATGTGGGTGG - Intronic
948679140 2:239620485-239620507 TGTCACATGGAGAATGAGAGCGG - Intergenic
948842939 2:240665189-240665211 TATAACATGGAAAATGTCAGTGG - Intergenic
1169973127 20:11292742-11292764 TACAACTTGGATAATGTGGGCGG + Intergenic
1170855005 20:20044214-20044236 TAATTCATGGAGAATGTATGAGG - Intronic
1173018003 20:39244244-39244266 TATTCCAGGGAAAATGTGGACGG + Intergenic
1174132269 20:48354112-48354134 TGCTGCATGGAGAATGTGGGTGG + Intergenic
1175665040 20:60851440-60851462 TTTTACTTGAACAATGTGGGAGG + Intergenic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177445066 21:21184080-21184102 TATTACTTGGGGAATGTGTTTGG + Intronic
1182553516 22:31115707-31115729 AATGACATGGAGAATGTTCGTGG + Intronic
1184744470 22:46448225-46448247 CATTACATGGAGACTCTGGCAGG + Intronic
949807639 3:7973458-7973480 GAAGACATGGAGAATGTGAGGGG - Intergenic
951031356 3:17885246-17885268 AATTTCATGGAGAATGGGGGTGG + Intronic
954598394 3:51847490-51847512 TTTTAAAGGGAGAATGAGGGAGG + Intergenic
955870215 3:63430645-63430667 TATTATATAGACAATGTGGAAGG + Intronic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
962240880 3:133749858-133749880 TTTTAAAGGGAGAATGAGGGAGG + Intronic
963838327 3:150079513-150079535 TATTTAATGTGGAATGTGGGTGG + Intergenic
964212745 3:154246307-154246329 TTGAACATGGAGAATGTGGCTGG + Intronic
964270715 3:154953057-154953079 TACAACATGGATAAAGTGGGAGG + Intergenic
964811080 3:160665368-160665390 TCTTACATGAAGAATCTGAGGGG + Intergenic
964834677 3:160924687-160924709 TATTACATTGAGATTGAGGAAGG - Intronic
965498300 3:169425962-169425984 TAACACATGGATAATGTGGAAGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
972417486 4:38856165-38856187 TATTAAATGGAGGAAGTGGCCGG - Intronic
973946134 4:55958088-55958110 GATTATACAGAGAATGTGGGGGG + Intronic
973959742 4:56097758-56097780 TGTTAGATGGAGAGAGTGGGAGG + Intergenic
974658399 4:64854994-64855016 TAGGAGATGGAGACTGTGGGAGG - Intergenic
975579805 4:75896200-75896222 TATTGCATGGAGAGGGTTGGGGG - Intronic
976152535 4:82106686-82106708 TATTACATGGGTAATGATGGGGG + Intergenic
977320182 4:95504132-95504154 TATTTCATAGAAAATGTCGGTGG - Intronic
977611932 4:99044495-99044517 TATTATATGTAGAATGTGTGAGG + Intronic
978740558 4:112132959-112132981 TATTATATGTATAATGTAGGGGG - Intergenic
978878330 4:113669487-113669509 TATTGAATGGAGACTGTTGGTGG + Intronic
981766055 4:148251252-148251274 TATTAGATGGAGACTGTGTTGGG - Intronic
981775239 4:148359664-148359686 TAAAATATGGAGAAAGTGGGAGG - Intronic
982120103 4:152135021-152135043 TATTACATGCACAATGGTGGGGG + Intergenic
982611475 4:157579418-157579440 TGTAACATGGAAAATGTGGGAGG + Intergenic
983865822 4:172765209-172765231 TATTACATGGAGAATGCAGAAGG + Intronic
984182699 4:176504370-176504392 AATTAGATGGAGAGGGTGGGAGG - Intergenic
985047864 4:185958556-185958578 TATTACTTAGTGACTGTGGGTGG - Intergenic
985140382 4:186833460-186833482 TAATACAGGAAGAATATGGGAGG - Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
988224669 5:28397876-28397898 TTTTAAAGGGAGAACGTGGGAGG + Intergenic
990806357 5:59667075-59667097 TATGAAATGGACAATGTGGGTGG + Intronic
991410179 5:66338083-66338105 TTTTACCTGGAGAGTGTGGTGGG + Intergenic
991653903 5:68883667-68883689 TCTTTCAGGGAGAAGGTGGGAGG - Intergenic
992371504 5:76148828-76148850 TATTCCTGGGAGAAAGTGGGTGG + Intronic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994104226 5:95928478-95928500 TATTAACTGGGCAATGTGGGAGG - Intronic
997138935 5:131357944-131357966 TGTTTCAAGGAGAAAGTGGGTGG - Intronic
1000868188 5:166540904-166540926 TAATAAATGGAGATTGTGGAAGG + Intergenic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1001047039 5:168381858-168381880 AATTTCACTGAGAATGTGGGGGG + Intronic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1004449923 6:15735931-15735953 TGTTACATGGAAAACGTGGGAGG - Intergenic
1005209723 6:23446718-23446740 CATTACATGGTGAATGCGGGAGG - Intergenic
1006795945 6:36732403-36732425 AATTTTAGGGAGAATGTGGGGGG + Exonic
1008149002 6:47927284-47927306 TGATATAGGGAGAATGTGGGTGG + Intronic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1008784384 6:55148379-55148401 TTTTAGATGAATAATGTGGGAGG - Intronic
1008901967 6:56630680-56630702 AATTACATGCAAAATGTGGGAGG + Intronic
1009036405 6:58121808-58121830 TATTACGAGGAGAGTGTAGGTGG + Intergenic
1009212216 6:60875425-60875447 TATTACGAGGAGAGTGTAGGTGG + Intergenic
1010490061 6:76465191-76465213 CCTTAGATGGAGAATGTAGGAGG - Intergenic
1014282543 6:119457755-119457777 AATTACATGGAGAAATTTGGGGG + Intergenic
1018385192 6:163296608-163296630 TTTTACATGGAGAATGTTTGGGG + Intronic
1020408762 7:7867004-7867026 TATTGCATGGAGGAAGTGAGAGG + Intronic
1020952418 7:14696558-14696580 TATTAGATGGAGAGTGGGAGGGG - Intronic
1020982628 7:15090400-15090422 TATTTCATGGAGAATATATGTGG + Intergenic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1022186728 7:27976420-27976442 TATTACAAGGAAAATCTGGCAGG + Intronic
1023975613 7:45027780-45027802 TATTCCATGGAGAATGAGGTAGG + Exonic
1028714128 7:93944771-93944793 TATTATAGAGAGACTGTGGGTGG + Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029321385 7:99763823-99763845 TGGTACATGGAGAAGGAGGGAGG - Intronic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1039711392 8:40059210-40059232 TATAAGATGGAGATTGTGGGGGG - Intergenic
1043355563 8:79408091-79408113 TATGACAATGAGAGTGTGGGTGG + Intergenic
1043467671 8:80528493-80528515 TATTACAGGGACAAGGTGCGGGG - Intergenic
1046478264 8:114778549-114778571 AATAACAAGGAGAATTTGGGTGG + Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1050104549 9:2152024-2152046 AATTACATGGAGACTATAGGAGG + Intronic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1052462438 9:28783309-28783331 GATTATATGAAGAATATGGGAGG - Intergenic
1059186860 9:112282087-112282109 GATTACATGATGAAGGTGGGTGG - Intronic
1060239734 9:121892723-121892745 TCTTCCATGGAGAATGTGGCGGG - Intronic
1060762213 9:126264144-126264166 GATAACATGGACAATGTGGAAGG - Intergenic
1060957945 9:127657578-127657600 TATTGTATAGAGAATGTGGTTGG + Intronic
1061733847 9:132638541-132638563 AATTACATTGTGAATGTGTGAGG + Intronic
1061764602 9:132873889-132873911 TATTACATGGTACAGGTGGGAGG - Intronic
1062444630 9:136588439-136588461 TATTTCCTGGTGAATGGGGGTGG - Intergenic
1186666930 X:11726663-11726685 TATGGCATAGAGACTGTGGGTGG - Intergenic
1189450951 X:41129904-41129926 TATTAAATGCATAATGTGAGGGG + Intronic
1190388989 X:49912794-49912816 TATTACATGGTATATGTAGGAGG + Intergenic
1193413523 X:81194998-81195020 TATTACTGGTAGGATGTGGGGGG + Intronic
1193691393 X:84648897-84648919 TATTATTTGTAGAATGTAGGTGG - Intergenic
1195472071 X:105241912-105241934 TTTTACATGCAAAATGTGTGAGG - Intronic
1195529150 X:105931910-105931932 TATTACATTCAGAATGTTGTGGG + Intronic
1195962142 X:110397246-110397268 ACTTACTTGGAAAATGTGGGTGG - Intronic
1196158246 X:112454389-112454411 TATTACAAGGAAAAGGAGGGAGG + Intergenic
1198650879 X:138862850-138862872 TAATGCTTGGAGAATGAGGGAGG - Intronic
1199704086 X:150409105-150409127 TGTTCCATGGAGACTTTGGGTGG + Intronic