ID: 1046759887

View in Genome Browser
Species Human (GRCh38)
Location 8:118010043-118010065
Sequence ATGAAGACACTGATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046759887_1046759889 -5 Left 1046759887 8:118010043-118010065 CCTTTGTCCATCAGTGTCTTCAT 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1046759889 8:118010061-118010083 TTCATTTGCCTATTGCAAGATGG No data
1046759887_1046759891 3 Left 1046759887 8:118010043-118010065 CCTTTGTCCATCAGTGTCTTCAT 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1046759891 8:118010069-118010091 CCTATTGCAAGATGGATGTTAGG No data
1046759887_1046759893 19 Left 1046759887 8:118010043-118010065 CCTTTGTCCATCAGTGTCTTCAT 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1046759893 8:118010085-118010107 TGTTAGGACTTAGAGTTGGCAGG No data
1046759887_1046759892 15 Left 1046759887 8:118010043-118010065 CCTTTGTCCATCAGTGTCTTCAT 0: 1
1: 0
2: 1
3: 42
4: 404
Right 1046759892 8:118010081-118010103 TGGATGTTAGGACTTAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046759887 Original CRISPR ATGAAGACACTGATGGACAA AGG (reversed) Intronic
901260948 1:7870260-7870282 ATGAGGACACAGATGCACAGAGG + Intergenic
902123893 1:14192150-14192172 ATTAAGACAGTGAGGAACAAAGG + Intergenic
902648657 1:17822254-17822276 ATGAAGAAACTGAGGCACAGGGG - Intronic
902759792 1:18573629-18573651 ATTATGACACTGCTGAACAAAGG - Intergenic
903005627 1:20296293-20296315 ACGGAGAAACTGATGGACATGGG - Intronic
904351090 1:29907187-29907209 ATGATGAGACTCATGGACAAAGG - Intergenic
904586850 1:31585452-31585474 ATGAAGGAGCTGATGGAGAATGG + Exonic
904761489 1:32807843-32807865 ATGAAGAGACTGAAGGAGAATGG - Intronic
905519268 1:38585636-38585658 CTGAAGACACTGACTGCCAATGG - Intergenic
905521126 1:38601074-38601096 ATGAAGACACTGAGATTCAAGGG + Intergenic
905823934 1:41015389-41015411 ATGAAGAAACTGAAGCACAGAGG + Intergenic
906701944 1:47865940-47865962 ATGAAGAGACTGAAGCACAGAGG - Intronic
907072002 1:51544163-51544185 ATGAAGAAACTGAGGCTCAAAGG + Intergenic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907716458 1:56930694-56930716 ATGAAGAAACTGAGGTTCAATGG - Intronic
907830388 1:58059311-58059333 ATGAAGAAACTGAGGTACATGGG - Intronic
907912914 1:58842296-58842318 ATGAAGACAGAGATAGACATTGG - Intergenic
907916428 1:58874036-58874058 GTGAAGACACTGAGGCACAAAGG - Intergenic
908022479 1:59912596-59912618 ATGAAAAAACTGAGGAACAAGGG + Intronic
908515221 1:64885327-64885349 ATAAAGACTCTCAAGGACAAAGG - Intronic
908635668 1:66161686-66161708 ATGAAGACACTGAGGGTCTATGG + Intronic
908678207 1:66629965-66629987 ATGAAGAAACTGAGAAACAAAGG + Intronic
908985523 1:70014879-70014901 ATGAAGAAACTGCTAGAAAAGGG - Intronic
909537912 1:76759008-76759030 ATGAAGAAACTGAGGCACAGAGG - Intergenic
909571975 1:77124014-77124036 ATGAAGACACTAGAGGAAAATGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910549449 1:88459613-88459635 ATGAAGACACTGATGAAGGTGGG - Intergenic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911261028 1:95685536-95685558 ATGAATACAGTGATAGAAAAGGG - Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912231452 1:107797619-107797641 ATGTAGACAATGGTGGAGAATGG + Intronic
912494598 1:110083462-110083484 ATGAAGAGAATGTTGGGCAATGG + Intergenic
913451503 1:118995723-118995745 ATGATGACTCTGAGGGGCAAGGG + Intergenic
914699175 1:150114956-150114978 ATTAAGACACTTTTAGACAAAGG - Intronic
914957184 1:152173266-152173288 ATGAAGACCCAGATAGAGAAAGG - Intergenic
915271618 1:154757712-154757734 ATGAGGACACTGATGACCAGGGG + Intronic
916454151 1:164953276-164953298 AGAAGGACACTGATAGACAATGG - Intergenic
916493542 1:165324780-165324802 ATGAAGAAACTGAGGTTCAAAGG + Intronic
916759481 1:167803628-167803650 ATGAGGAAACTGATGAAAAAGGG + Intergenic
918013668 1:180611425-180611447 ATGATGACACAGAAGCACAAGGG + Intergenic
918731127 1:187998222-187998244 ATAAAGACAATGATTGAGAAAGG - Intergenic
919045855 1:192450858-192450880 ATGAAGACATTGAGGGTAAAGGG + Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
920779979 1:208979984-208980006 ATGAGGAAACTGATCTACAATGG - Intergenic
921000034 1:211035027-211035049 ATGAAGACACTATTGAACTAAGG - Intronic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
921540517 1:216408847-216408869 ATGGAGAAGCTGCTGGACAAAGG + Intronic
921955465 1:220979150-220979172 ATGGAGACAATGATCAACAATGG - Intergenic
921964918 1:221077929-221077951 AAGAGGAAACTGATGGACAAAGG + Intergenic
922248577 1:223825287-223825309 ATGAAAACACTGAAGCACAGAGG + Intronic
923618306 1:235556217-235556239 ATGAGGAAACTGAGGCACAAAGG + Intronic
924031565 1:239890468-239890490 ATGAGGACACTGATGCTCAGAGG - Intronic
924306296 1:242692222-242692244 AAGAACAGACTCATGGACAAAGG + Intergenic
924676268 1:246181241-246181263 ATGATTGCACTGAAGGACAAAGG + Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1063539185 10:6914835-6914857 ATTCAGACACTGAGGGAAAAAGG + Intergenic
1063550369 10:7027005-7027027 ATGAAGAAACTGAGGCACAGAGG + Intergenic
1063918490 10:10908543-10908565 ATAAATACACTGTTGGAGAAAGG + Intergenic
1064390896 10:14941265-14941287 ATAAAGGAGCTGATGGACAATGG - Intronic
1064401261 10:15023246-15023268 ATAAAGGAGCTGATGGACAATGG - Intergenic
1065413534 10:25458672-25458694 ATGAAGAAACTGAGGCTCAAAGG + Intronic
1066203290 10:33162271-33162293 ATGAAGACATTAAAAGACAATGG - Intergenic
1067432151 10:46251814-46251836 TGGAAGCCACAGATGGACAAGGG - Intergenic
1068292971 10:55029764-55029786 ATGTAGACAATGATGGGTAAGGG + Intronic
1068483467 10:57625796-57625818 ATGAAGACACTGGAGGAAGACGG - Intergenic
1068813648 10:61285334-61285356 ATGAAGAAACTGAAGCTCAAAGG + Intergenic
1069272371 10:66545517-66545539 CTGAAGACACTGATGCATATAGG - Intronic
1069614242 10:69796733-69796755 ATGTAGAGATTGATGGGCAAGGG - Intergenic
1069900417 10:71703684-71703706 ATGAAGAAACTGAGGCACAGCGG - Intronic
1069908310 10:71745201-71745223 ATGAAAACACTGGTGTGCAATGG + Intronic
1071693846 10:87851506-87851528 ATGAAGAAACTGAGGCGCAAAGG - Intergenic
1071704341 10:87981111-87981133 ATGAAGAAACTGAGGCACAGAGG - Intergenic
1071901470 10:90124813-90124835 ATGCAGACACTGGTGGGGAAAGG - Intergenic
1072349993 10:94547317-94547339 ATGAAGAAACTGAGGGAGAAGGG + Intronic
1072544245 10:96422367-96422389 AGGAAGCCACAGATGGACAGTGG + Intronic
1074446332 10:113524223-113524245 AAGAACACACTGATGGACCATGG - Intergenic
1075667772 10:124243270-124243292 ATGAAGAAACTGAGGCACAGTGG - Intergenic
1076177730 10:128381249-128381271 ATGAGGACACTGAGGCACAGAGG - Intergenic
1076552101 10:131287809-131287831 ATGAGAACACTGAGGGACAGGGG + Intronic
1076720957 10:132392905-132392927 ATGAGGACACTGAGGCACAAGGG + Intergenic
1076944394 10:133635700-133635722 AAAAAGACACTGATGGTCAATGG + Intergenic
1080298723 11:30759721-30759743 ATGAGGACACTCATGTTCAAAGG - Intergenic
1080366688 11:31582181-31582203 ATGAAGACATTGAAACACAAAGG - Intronic
1080786521 11:35479820-35479842 ATGAAGACACTCAGGCACAGAGG - Intronic
1081406504 11:42704930-42704952 ATGAGGACACAGATGGGTAAAGG - Intergenic
1081648603 11:44807769-44807791 ATGAGGAAACTGATGTCCAAAGG - Intronic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1083486589 11:62986732-62986754 ATGAGGACACTGAGGTACAGAGG - Intergenic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1084923189 11:72488993-72489015 ATCAAGACATTTATGAACAAAGG + Intergenic
1085382494 11:76133003-76133025 ATGAAGAAACTGAAGCACAGAGG - Intronic
1085483166 11:76839313-76839335 ATGAGGAGACTGAGGGTCAAAGG - Intergenic
1086095494 11:83046374-83046396 ATGAGGAAACTGAAGGCCAAAGG - Intronic
1086121174 11:83305706-83305728 ATGAAGACACTGAGGCTCAGAGG + Intergenic
1089501759 11:118936156-118936178 AAGAAGACGCTGATGGACAGGGG - Intronic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1090621692 11:128566432-128566454 ATGAAGACACTGAGGTTCAGAGG + Intronic
1090948574 11:131452648-131452670 ATGAAGACACTGAGGCTGAAGGG + Intronic
1091196201 11:133732785-133732807 GTGAAGACAAGGAGGGACAAGGG + Intergenic
1091898108 12:4120778-4120800 ATGGAGATACTGATGGTCACAGG + Intergenic
1092326664 12:7538942-7538964 ATGAAGAAACTGATGGGCTCAGG - Intergenic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1093051334 12:14508261-14508283 ATGAAGAAACTGAGGCACAAAGG - Intronic
1093192299 12:16088948-16088970 ATGAAGACATTGAAAAACAAAGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095126232 12:38480639-38480661 ATGAGAACACTGAGGCACAAAGG + Intergenic
1095935129 12:47671672-47671694 ATGAAGATACTGATCAAGAATGG + Intronic
1096980515 12:55725958-55725980 GGGAAGAGACTGATGGACCAAGG - Intronic
1097167481 12:57093496-57093518 CAGCAGACACTGATGGACGAGGG + Exonic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098428823 12:70396625-70396647 ATGAGGAAACTGAGGGACAGAGG - Intronic
1100360388 12:93872691-93872713 ATGAAAACACTTTTTGACAAAGG - Intronic
1101198197 12:102407323-102407345 AGGAACAAACTGATAGACAAAGG + Intronic
1101696246 12:107130177-107130199 ATGAAGAAACTGAGGCCCAAAGG + Intergenic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1103387763 12:120547017-120547039 ATAAAGACATTTATGTACAAGGG + Intronic
1103633481 12:122282722-122282744 AGCAAGACACAGAGGGACAAAGG + Intronic
1104298292 12:127539254-127539276 ATGAAGAAAATGTTGGAAAATGG - Intergenic
1104461929 12:128963211-128963233 AGGAGGACACTGATGGCCAGAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107779824 13:43887050-43887072 ATGCAGACAGTGATGTTCAAAGG - Intronic
1109553839 13:63943126-63943148 ATGAAGACCCTCATGTACAGGGG + Intergenic
1110837827 13:80105335-80105357 ATGGAGAGAATGATGGTCAAAGG - Intergenic
1112216673 13:97437738-97437760 ATGAAGGATCTGATGGAAAAGGG + Intronic
1113207244 13:107931352-107931374 ATGAAGCAACTGAGGGACAAGGG + Intergenic
1114272494 14:21110395-21110417 ATGAAGACACGCAGGGATAATGG + Intergenic
1114969450 14:28006967-28006989 ATGAGGTGACAGATGGACAAAGG - Intergenic
1115417226 14:33149978-33150000 ATGAAAACACACATGGACACAGG - Intronic
1116466903 14:45244503-45244525 ATGAAGTGACAGAAGGACAAAGG - Intronic
1118300904 14:64615119-64615141 ATTTAGCCACGGATGGACAAAGG - Intergenic
1118808404 14:69257084-69257106 ATGATGACACTGAAGCTCAACGG - Intergenic
1119382224 14:74236559-74236581 ATGAAGAAACTGAGGCACAGAGG + Intergenic
1119548359 14:75489949-75489971 ATGAAGAAACTGAGGCACAGAGG - Intergenic
1119643518 14:76331343-76331365 ATGAGGAAACTGAGGCACAAAGG - Intronic
1121045406 14:90784226-90784248 ATGATGACACAGGTGGACACAGG - Intronic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1121661189 14:95636350-95636372 ATGAAGAAACTGAGGGTCAGAGG - Intergenic
1122098250 14:99386974-99386996 ATAATGGCATTGATGGACAAGGG + Intergenic
1122249915 14:100430634-100430656 ATGAGGACACTGAGGCACAGTGG + Intronic
1122536330 14:102466107-102466129 ATGTAGACAGTTATGCACAAAGG - Intronic
1202917791 14_KI270723v1_random:1039-1061 AAAAAGACACTGAAGGTCAATGG + Intergenic
1202926834 14_KI270724v1_random:33546-33568 AAAAAGACACTGATGGTCAATGG - Intergenic
1128321724 15:66699287-66699309 ATAAAGACACTGAGGCACAAAGG - Intergenic
1129229599 15:74189384-74189406 ATAAGAACACTGATGGGCAATGG - Intronic
1129502507 15:76053347-76053369 ATGAAGAAACTGAGGCACAGAGG - Intronic
1129503965 15:76065621-76065643 ATGAGGACACTGAGGTACGAGGG - Intronic
1129815524 15:78549561-78549583 ATGAAGCCACAGATAGCCAAGGG - Exonic
1133549654 16:6841788-6841810 ATGAAGACAGTGATGTTCACTGG - Intronic
1135243067 16:20827749-20827771 ATTAAGACACATATGTACAAAGG + Intronic
1135523369 16:23194405-23194427 ATGGAAACACTGATAGAAAAAGG - Intronic
1135525767 16:23212664-23212686 AACAATACACTGAGGGACAAGGG - Exonic
1135605906 16:23824399-23824421 ATGAAGAAACTGAGGCACAGAGG - Intergenic
1136328453 16:29551295-29551317 GTGATGACACTGATGGAGGAGGG + Intergenic
1136443138 16:30291309-30291331 GTGATGACACTGATGGAGGAGGG + Intergenic
1137799222 16:51247303-51247325 AGGAAATCACCGATGGACAAGGG + Intergenic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1139068950 16:63356418-63356440 ATGTAGATATTGATGGACCAGGG + Intergenic
1139959817 16:70711054-70711076 ATGAGGACACTGATGGGACAGGG - Intronic
1140080021 16:71737159-71737181 ATGAAGACACTGAGGCATAGAGG + Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141323380 16:83033230-83033252 CTGAAGTCACTGAAGGTCAATGG - Intronic
1141530437 16:84642938-84642960 ATGGAGAAACTGAGGCACAACGG + Intergenic
1141789717 16:86226335-86226357 AGGAAGCAACTCATGGACAAGGG - Intergenic
1141920371 16:87131791-87131813 ATGAAGAAACTGAGGCACAGAGG + Intronic
1142874987 17:2846702-2846724 ATGAAGACACTGAGGCACAGAGG + Intronic
1143283100 17:5769537-5769559 GTGAAGACACTGAGGGCAAAAGG - Intergenic
1143346014 17:6249851-6249873 AACAAGTCACTGAGGGACAATGG - Intergenic
1144587788 17:16498476-16498498 GTGTCGGCACTGATGGACAACGG - Intergenic
1145018200 17:19412361-19412383 ATGGAGGCACTGATGGAAATTGG + Intronic
1145767229 17:27467093-27467115 ATGAAGAAACTGAGGCACAGAGG + Intronic
1146483870 17:33227759-33227781 ATAAAGAAACTGAAGCACAAAGG + Intronic
1146837432 17:36123498-36123520 ATGAAGAAACTGAAGCTCAAAGG - Intergenic
1150291822 17:63986825-63986847 ATGAGGACACTGAGGGACAGGGG + Intergenic
1150735573 17:67734225-67734247 ATGAAGACAGTGATTGCCACAGG - Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1155989991 18:32270304-32270326 ATGGAGGGACTGGTGGACAAAGG + Exonic
1156610853 18:38722521-38722543 ATGGATAGACTGATGGACAGAGG - Intergenic
1156720492 18:40063610-40063632 ATGCAAACACTTATGAACAATGG - Intergenic
1157291914 18:46415713-46415735 ATGAAGAAACTGAGGCTCAAGGG - Intronic
1157374235 18:47148964-47148986 ATGAAGAAACTGAGGCAAAAAGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158983531 18:62789581-62789603 GAGAAGACACTGATGAAGAATGG - Intronic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160109621 18:76013859-76013881 ATACAGACACTGAAGGAAAACGG - Intergenic
1160253588 18:77226666-77226688 ATGAAGAAACTGATGGATATGGG + Intergenic
1160958009 19:1703237-1703259 ATGAACAGGCTGATGTACAATGG - Intergenic
1163505774 19:17705286-17705308 ATGAGGAAACTGAGGCACAAAGG + Intergenic
1163569518 19:18072428-18072450 ATGAAGACAGACTTGGACAAAGG + Intronic
1164052116 19:21592580-21592602 ATGAAGAAACTGAGGCACAGAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164806969 19:31124507-31124529 ATGATGGCACTGAGAGACAAAGG + Intergenic
1165262987 19:34636743-34636765 ATAAAAACAATGATGGACACTGG + Intronic
1165708529 19:37993178-37993200 ATGAAGAAACTGAGGGGCAGGGG - Intronic
1166562230 19:43740550-43740572 ATGAGGAAACTGATGGAAAAAGG - Intronic
1167850650 19:52198781-52198803 GTGAGGACACTGATGCACAGAGG - Intronic
1168271284 19:55251132-55251154 AGGGAGACAGTGGTGGACAAAGG - Intronic
1168671532 19:58244503-58244525 ATAAAGACACAGTCGGACAACGG - Intronic
925709436 2:6724493-6724515 ATGAAGACACTCTTGGAACATGG + Intergenic
926132416 2:10312398-10312420 ATGACGACATTGATGGTGAATGG - Intronic
926132452 2:10312743-10312765 ATGATGACAGTGATGGTGAATGG - Intronic
926151612 2:10428649-10428671 GTGAAGACACTGAGGCACAGAGG - Intergenic
926353713 2:12020813-12020835 ATGAGGAAACTGAGGCACAAAGG - Intergenic
926502066 2:13668052-13668074 ACGCAGATACAGATGGACAATGG + Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
927282102 2:21317925-21317947 ATGTAGAGTCTGATGGACAGAGG + Intergenic
927613828 2:24568839-24568861 ATGAAAGCACTGATGTACAGAGG + Intronic
930006201 2:46899020-46899042 ATGAGGAAACTGAGGCACAAAGG + Intergenic
930714240 2:54577668-54577690 ATGAGGAAACTGAGGCACAAAGG + Intronic
930751905 2:54942766-54942788 GTTAAGACACTGAGGGACAAAGG - Intronic
931082583 2:58792088-58792110 ATGAAGACACTGAGGTTCAGAGG + Intergenic
931786765 2:65626205-65626227 AACAAGATACTGATGGAAAAGGG + Intergenic
931980250 2:67686600-67686622 AGAAAGACACTCATGGATAATGG + Intergenic
932192280 2:69751098-69751120 ATGAGGAAACTGAGGCACAAAGG + Intronic
932792078 2:74662510-74662532 AGGAATAAACTGATGAACAAAGG + Intronic
933082755 2:78013829-78013851 ATTTAGACACTTATGTACAAAGG - Intergenic
935890994 2:107677997-107678019 ATCAAGGCCCTGATGGTCAAAGG - Intergenic
936398847 2:112150692-112150714 AGGAAGAAACTGATTCACAAGGG - Intronic
936674213 2:114696189-114696211 AGCAAGACATTGATGGAAAATGG - Intronic
937319894 2:120954897-120954919 TTGAAGACTCTGCTGGACTATGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938992730 2:136645908-136645930 AAGAAGTCACTGATGATCAAAGG - Intergenic
939820550 2:146951892-146951914 ATGAGGACACTGATGGTTAGAGG - Intergenic
940026939 2:149218424-149218446 ATGAGGACACGCATGGACATGGG + Intergenic
940810660 2:158239002-158239024 ATGAAGAAACTGAGGCACATAGG - Intronic
940983602 2:160029941-160029963 ATTAAGACCCTGACGGATAAGGG + Intronic
941443807 2:165574471-165574493 TTAAAGACACTGATGGGCATTGG + Intronic
941813051 2:169773088-169773110 AATAAGACACTGTTGCACAATGG + Intronic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942817097 2:180064769-180064791 ATGAAGGAACTGATGCCCAATGG - Intergenic
942832924 2:180257811-180257833 ATGAAGAAGCTGAGGGACAGAGG + Intergenic
943407667 2:187510009-187510031 GTGATTACACTGGTGGACAATGG - Intronic
945037392 2:205715788-205715810 ATGAAGAAATTGATGCTCAAAGG + Intronic
945188830 2:207166213-207166235 ATGAAGTCACTGAGGACCAATGG + Intronic
945500569 2:210568250-210568272 AGGAAGACATTTATGCACAAAGG + Intronic
945674935 2:212844807-212844829 ATGAAGATACTTAGGGAAAAGGG + Intergenic
945805766 2:214488175-214488197 GTAAAGACATTGATGAACAAAGG - Intronic
946755750 2:222945743-222945765 ATAAAGACACTAATGGGGAAGGG - Intergenic
948017270 2:234700935-234700957 AAGAGAACCCTGATGGACAAGGG + Intergenic
948619242 2:239223645-239223667 ATGAGGACACTGATGGCCACAGG - Intronic
1169511641 20:6270155-6270177 ATGAAGAAACTGAAGCATAAGGG - Intergenic
1170056576 20:12211524-12211546 ATGAAAACACAGATGCACACTGG + Intergenic
1170915309 20:20618267-20618289 ATGGAGCTACTGAGGGACAAAGG + Intronic
1171083632 20:22214826-22214848 ATGAAGAAACTGAGGCACAGGGG + Intergenic
1171114612 20:22513838-22513860 ATTTAGACCCAGATGGACAACGG - Intergenic
1171781752 20:29425687-29425709 AAAAAGACACTGATGGTCAATGG + Intergenic
1172413036 20:34740688-34740710 ATGGAGAGACTGAAGGCCAAGGG - Exonic
1172814534 20:37675937-37675959 ATGGAAAAACTGATGGACATGGG - Intergenic
1172870280 20:38131365-38131387 ATGAAGAAACTGAGGCACAGAGG - Intronic
1172962675 20:38809482-38809504 ATGAGGACACTGTGGGATAAAGG + Intronic
1173124690 20:40325799-40325821 CTGATCACACTGATTGACAAAGG - Intergenic
1173161690 20:40657563-40657585 ATGAAGACACTGAGGCAGAGTGG + Intergenic
1173711559 20:45161480-45161502 ATGAAGACAAAGATACACAAAGG + Intergenic
1173761298 20:45562820-45562842 ATGAAGACACATATGGGAAATGG - Intronic
1174050014 20:47760992-47761014 ATGAGGAAACTGAGGCACAAAGG - Intronic
1175923833 20:62462475-62462497 ATGAGGATACTGAGGCACAAGGG - Intergenic
1176043691 20:63081544-63081566 ATGTGGACACACATGGACAAGGG + Intergenic
1176077928 20:63257045-63257067 AGGAGGACAGTGATGGACAGAGG + Intronic
1176077965 20:63257315-63257337 CAGAGGACAGTGATGGACAATGG + Intronic
1177736058 21:25091819-25091841 ATGAAGCCAGTGATGGAGTAGGG + Intergenic
1178731977 21:35112255-35112277 ATGAAAAGACTGAGGTACAAAGG + Intronic
1178769842 21:35493009-35493031 AAGAAAACACTGATAGAAAATGG + Intronic
1178949224 21:36972533-36972555 GTGAAACCTCTGATGGACAATGG + Intronic
1179382639 21:40913618-40913640 ATGAGGAAACTGAGGCACAAAGG - Intergenic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1181467641 22:23118711-23118733 AGGAAGTCACTGCAGGACAAGGG + Intronic
1181879013 22:25962568-25962590 ATGCAGACATGGATGGACTAGGG + Intronic
1182114557 22:27748199-27748221 CTGAAGAGACTGATGTAAAAAGG + Intergenic
1182373773 22:29830967-29830989 ATGGAAACACTGATGGAGACTGG - Intronic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1182944722 22:34311104-34311126 ATGAAAAAACTCATGGACAGAGG + Intergenic
1183091139 22:35523005-35523027 ACACAGACACTGGTGGACAAGGG + Intergenic
1183312851 22:37120701-37120723 ATGAAGAGACTGAGGCTCAAAGG + Intergenic
1183486622 22:38090579-38090601 ATGGAGTCACTGCTCGACAAAGG - Intronic
1184283159 22:43450334-43450356 GTGAAGACACTGAGGCACAGGGG - Intronic
1184387373 22:44183755-44183777 ATGAGGAAACTGAGGCACAAGGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950182989 3:10928043-10928065 ATGAAGACACAGAAGCACAGAGG - Intronic
950321408 3:12058004-12058026 ATGTAGATTCTGATGGAGAAGGG - Intronic
950830682 3:15872622-15872644 ATGAATACAGTCATGGACCATGG + Intergenic
951572400 3:24078670-24078692 ATGAAGACACTGAGGCTCAAGGG + Intergenic
951587422 3:24229699-24229721 AGGATGACACAGATGGACACTGG + Intronic
951644670 3:24875902-24875924 GTGAAGACCTTGAAGGACAAGGG - Intergenic
954857870 3:53662293-53662315 ATTAAGAGACTGAGGGAGAATGG + Intronic
955457069 3:59134779-59134801 ATGAAGAAACTGAGGCTCAAGGG + Intergenic
955892732 3:63667107-63667129 ATGAGGAAACTGAAGCACAAAGG + Intronic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
957083755 3:75660713-75660735 AAAAAGACACTGATGGTCAATGG - Intergenic
957428681 3:80072732-80072754 CAGAAGACAGTGATGGAAAATGG - Intergenic
957690740 3:83563490-83563512 TTGAAGACACTCATGAGCAAGGG + Intergenic
957777304 3:84770024-84770046 TTGCAGACACTGAAGAACAAAGG + Intergenic
958434029 3:94075931-94075953 ATGAAGACCCTGAAGGAATATGG - Intronic
958648116 3:96899267-96899289 ATGAAGACACAGATATACATAGG - Intronic
959168020 3:102805145-102805167 ATGAGGAAACTGAGGGAGAAAGG + Intergenic
962107190 3:132403099-132403121 ATGAGGAAACTGAGGCACAAAGG + Intergenic
962157728 3:132966201-132966223 ATGAAGAAACTGAGGCACAGAGG + Intergenic
962424996 3:135261894-135261916 ATGAGGAAACTGAGAGACAAAGG + Intergenic
963373098 3:144427247-144427269 CTAATAACACTGATGGACAATGG + Intergenic
963722119 3:148873660-148873682 ATGAAGGCACTATTGTACAATGG + Intronic
963766004 3:149336511-149336533 ATGAAGAGAGGGATGGGCAAAGG + Intergenic
964037122 3:152213008-152213030 AGGGAGACACTGAGGGACAGAGG + Intergenic
964795694 3:160494502-160494524 ATGAAGAAACTGAAGCACATAGG + Intergenic
964931618 3:162031629-162031651 ATTAAGACACTAATTGACAATGG + Intergenic
966989031 3:185210033-185210055 AGGAAGACAAGAATGGACAATGG + Intronic
968250302 3:197204467-197204489 ATTAACACACTGATGGATGAGGG - Intronic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
969855171 4:9993409-9993431 ATGATGACACTAGTGAACAAAGG + Intronic
970058475 4:12001880-12001902 ATGAAAACACTTATGCACCAAGG + Intergenic
970174046 4:13320191-13320213 AAGAAGACACTGAAAGAGAAGGG - Intergenic
971876322 4:32313571-32313593 TTGCAGACACAGAAGGACAATGG + Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972534385 4:39987472-39987494 ATTAAGACACTGCTGGTCAGTGG - Intergenic
972641073 4:40925384-40925406 ATGAAGAAACTGAGGCACAGAGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974281607 4:59802345-59802367 ATTAAGACATTAATGAACAACGG + Intergenic
974939887 4:68454011-68454033 ATGCTGACTCTTATGGACAAGGG + Intronic
975974156 4:80075751-80075773 AGGAAGATACTGAGGGGCAAGGG + Intronic
976729371 4:88246337-88246359 AAGGATACACTGATGAACAAAGG - Intergenic
977296382 4:95214015-95214037 ATGAAGAAACTGAGGCACAGGGG - Intronic
977455456 4:97254485-97254507 ATGAGGAAACTGAGGGGCAAAGG + Intronic
977849064 4:101802203-101802225 ATTAAGACACTGATACAGAAGGG - Intronic
978078130 4:104558701-104558723 ATGAAGAAACTCATGCACAGAGG + Intergenic
978514132 4:109553312-109553334 TAGAAGACACTGATGAAGAAGGG - Intergenic
978988157 4:115042267-115042289 CTGATGACATTGATGGCCAAAGG - Intronic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981168148 4:141587671-141587693 AAGAAGAAACTGAAAGACAAAGG - Intergenic
981408671 4:144401880-144401902 ATGAAGATAATGAAGGAAAAGGG + Intergenic
981548475 4:145918594-145918616 ATGAAGAAACTGAGGCACAAAGG - Intronic
982732527 4:158971812-158971834 ATGAAGACACTGACGCACAGAGG + Intronic
983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG + Intronic
984039757 4:174716575-174716597 ATGAAGACACTGAATTTCAATGG - Intronic
984557842 4:181236736-181236758 ATAAAGACACTGATGTTCATAGG - Intergenic
985126915 4:186703656-186703678 AAGAAGACCCTGGTGGACATGGG + Intronic
985184510 4:187301555-187301577 ATGTAGACACTTCTGGGCAATGG + Intergenic
985447770 4:190036216-190036238 AGAAAGACACTGATGGTCAATGG + Intergenic
985852035 5:2395800-2395822 ATGAAGAAACTGAGGTGCAAAGG - Intergenic
986424142 5:7613558-7613580 ATGAACACACTGATGTGCCAGGG - Intronic
987391357 5:17378523-17378545 ATGAAGACACTAGTGGGAAATGG + Intergenic
988126377 5:27043610-27043632 ACTAAGACACTGATGGCCAAAGG + Intronic
988433064 5:31142230-31142252 ATGGAGGCCCTGATGGATAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989105752 5:37861707-37861729 ATAAAGACACTTGTGCACAAGGG + Intergenic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
995288946 5:110427228-110427250 ATGAAGAAACTGAAGAACAGAGG - Intronic
995934947 5:117499416-117499438 ATGAAGACACAGGTGAACTAGGG - Intergenic
996337147 5:122397112-122397134 GTGAAGAGACTGATATACAAAGG + Intronic
996753194 5:126909836-126909858 ATGAAGTCACTGGAGGACAATGG - Intronic
996875835 5:128239446-128239468 ATGATGACACTCAAGGAGAATGG - Intergenic
997125447 5:131222371-131222393 ATGAGGAAACTGAGGGACAGAGG - Intergenic
997792607 5:136774512-136774534 ATCAAGGAACTGATTGACAATGG - Intergenic
998063370 5:139136683-139136705 ATGAAGACATAGAGGCACAAGGG + Intronic
999319892 5:150607590-150607612 ATGAAGAAACTGAGGAACAGAGG + Intronic
999670626 5:153956264-153956286 ATGAAGACTTTGTTGGATAAGGG + Intergenic
1000173699 5:158728982-158729004 ATGAAGAAACTGAGGCACAGAGG + Intronic
1000408019 5:160909133-160909155 ATGAAGGCTCTGATAGAGAAGGG + Intergenic
1001180903 5:169519560-169519582 ATGAGAACACTGAGGTACAAAGG + Intergenic
1001779712 5:174357441-174357463 ACAAAGACACTGATGGGCATGGG + Intergenic
1001858799 5:175035226-175035248 ATGATGATGATGATGGACAAAGG + Intergenic
1002511329 5:179720406-179720428 ATGAAGACATGGATGGAGAATGG + Exonic
1002845552 6:941464-941486 ATGAAGAAACTGAGGGTCACAGG - Intergenic
1002895261 6:1375841-1375863 ATGATGACTCTCATGGACCAAGG + Intergenic
1004333347 6:14741371-14741393 ATAAAGACACTTATGGACACTGG - Intergenic
1006822248 6:36906434-36906456 ATGAGGAAACTGATGTGCAAGGG + Intronic
1009848599 6:69165871-69165893 ATGAAGAAACTGAGGCACAAGGG + Intronic
1009862926 6:69358191-69358213 ATGATAACACTGATGGTCTAGGG - Intronic
1010901170 6:81429746-81429768 ATGAAAATAATGATGTACAAAGG - Intergenic
1012556765 6:100522783-100522805 ATGAAGACACTGGTTTACAAAGG + Intronic
1012562118 6:100595652-100595674 ATGAGCACAGTGATGGAGAATGG + Intronic
1012975679 6:105778789-105778811 ATGAAGACACTGAGTAGCAAAGG - Intergenic
1013097548 6:106959340-106959362 ATGAAGAAACTGAAAGACATTGG - Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013721297 6:113031703-113031725 ATGAAGACAGTGATAGGCACTGG + Intergenic
1014106465 6:117569330-117569352 GTGAGGACACTGAGGGACAGAGG + Intronic
1014605608 6:123470410-123470432 ATGAAATTACTGAGGGACAATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021159784 7:17258854-17258876 ATGAACTCACTTAAGGACAAAGG + Intergenic
1021290035 7:18831906-18831928 ATGCTGAAACTGCTGGACAAAGG - Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021545625 7:21810394-21810416 ATGGAGACAAAGATGGACATGGG + Intronic
1021857424 7:24871054-24871076 ATGAAGAAACTGGAGTACAAAGG + Intronic
1021922858 7:25504255-25504277 AGGTAGACACTGAGGCACAATGG + Intergenic
1023342858 7:39240407-39240429 ATGAGGAAACTGAGGCACAAAGG - Intronic
1024433430 7:49318950-49318972 ATTAAGACAGTGATTGACCACGG + Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026065635 7:67069944-67069966 ATTAAGACACTGATAAATAAAGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027188802 7:75986431-75986453 ATCAAGAAACTGATGACCAAGGG + Exonic
1028118794 7:87033227-87033249 ATGAAGAAACTGAAGCTCAAAGG - Intronic
1028185795 7:87784652-87784674 ATGAAGGCACTGAAATACAAAGG - Intronic
1029132364 7:98341663-98341685 ATGAGGAGACTGAGGTACAAAGG - Intronic
1030648269 7:112088810-112088832 ATGAGGAAACTGAGGGACAAAGG - Intronic
1030961290 7:115926762-115926784 ATGAGGAGACTGATGCACAGAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035421245 7:158730423-158730445 GTGAAGACAGTGTTGGAAAATGG + Intergenic
1037124891 8:15335815-15335837 AGGAAGACGCTTATGGACAAAGG - Intergenic
1037202745 8:16277908-16277930 ATGAAGACATTGATTGACCTTGG + Intronic
1037706278 8:21317683-21317705 ATGAAGACTCCCATGGGCAATGG - Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1042527931 8:69784208-69784230 ATTAAAACACTAATGGAGAAAGG + Intronic
1042793625 8:72635936-72635958 ATGAGGAAACTGAGGCACAAAGG - Intronic
1043527649 8:81113247-81113269 AGGAAGACAGTGATGGAGTAAGG + Intergenic
1044224242 8:89701384-89701406 ATGAAGAAAATGATGGACAGTGG - Intergenic
1044573207 8:93742250-93742272 ATGAAGAAACTGAGGCACAGAGG - Intergenic
1045761243 8:105610346-105610368 ATGATGTCACTGATGGTCTAGGG + Intronic
1046139822 8:110076663-110076685 ATGATGACAGTGATAGATAATGG + Intergenic
1046759887 8:118010043-118010065 ATGAAGACACTGATGGACAAAGG - Intronic
1048357001 8:133661765-133661787 ATGAAGACAGAGAGGGACAGGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048919247 8:139212952-139212974 ATGAGGACACTGAGTCACAAAGG + Intergenic
1049930055 9:447644-447666 ATGGAGAAACTGATGAACCATGG - Intronic
1051880176 9:21832014-21832036 ATGAGGACACTAAGTGACAAAGG - Intronic
1052072506 9:24099621-24099643 AAGAAGACACTCATTGAAAATGG + Intergenic
1052459993 9:28750685-28750707 ATGAAGAAACTGAGGCTCAAAGG - Intergenic
1055840787 9:80500585-80500607 ATGAAGACACTGAGGGCTGAAGG + Intergenic
1056405639 9:86271775-86271797 ATGAAGAAACTGAGGCACAGAGG - Intronic
1058637682 9:107052347-107052369 ATGAAGAAACAGAGGCACAATGG + Intergenic
1058823421 9:108753759-108753781 ATAGAGACAGGGATGGACAATGG - Intergenic
1059137773 9:111823453-111823475 ATAAAAAAACTGATGGGCAAGGG + Intergenic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1060316158 9:122512767-122512789 AAGAAGTCACAGATGGACACTGG - Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1062300411 9:135864489-135864511 ATAATGACACTGAAGGACACAGG + Intronic
1062666148 9:137673694-137673716 TTGAAGACACTGATGAACACTGG - Intronic
1203340125 Un_KI270320v1:4008-4030 CTGAAGACTTTGATGGAAAAGGG + Intergenic
1185531098 X:819845-819867 GTGTAGACGCAGATGGACAAGGG - Intergenic
1187003754 X:15209841-15209863 AAGAATACACTGAAGGCCAAGGG - Intergenic
1187144757 X:16627166-16627188 ATTAAGACACTGGTGCAAAAAGG - Intronic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1188422287 X:30004879-30004901 ATGAAGACACTGAAGTTCACAGG - Intergenic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1189564106 X:42221767-42221789 ATGAAAAAACTGAGGGCCAAAGG + Intergenic
1190372901 X:49759849-49759871 ATGAAGAAACTGAGGCACAGAGG + Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1193652297 X:84152068-84152090 CTGAAGACACTGTTGCATAAAGG + Intronic
1194853645 X:98901027-98901049 ATGAAGAAACTGAAGCCCAAAGG - Intergenic
1195170089 X:102259159-102259181 AAGAAGGCAGTGATGAACAATGG - Intergenic
1195188768 X:102427941-102427963 AAGAAGGCAGTGATGAACAATGG + Intronic
1197504995 X:127290455-127290477 AAGAGGACACTGATAGTCAATGG - Intergenic
1199084381 X:143611843-143611865 ATGAAGATAGTGAGGGAGAAAGG - Intergenic
1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG + Intronic
1199575430 X:149309063-149309085 ATGAGGAAACTGAAGCACAAGGG - Intergenic
1199697036 X:150349939-150349961 ATGAAGAAACTGATGGTCTCTGG + Intergenic
1199861440 X:151803570-151803592 ATGCAGACAATGATCAACAATGG - Intergenic