ID: 1046760716

View in Genome Browser
Species Human (GRCh38)
Location 8:118017217-118017239
Sequence ATGTATAAGGAGAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046760716_1046760719 -6 Left 1046760716 8:118017217-118017239 CCTACCTCATTCTCCTTATACAT 0: 1
1: 0
2: 0
3: 17
4: 336
Right 1046760719 8:118017234-118017256 ATACATTATCCTCTCTTTTTAGG No data
1046760716_1046760723 26 Left 1046760716 8:118017217-118017239 CCTACCTCATTCTCCTTATACAT 0: 1
1: 0
2: 0
3: 17
4: 336
Right 1046760723 8:118017266-118017288 AAGCTTGTCTCAGCTGGCCTGGG No data
1046760716_1046760722 25 Left 1046760716 8:118017217-118017239 CCTACCTCATTCTCCTTATACAT 0: 1
1: 0
2: 0
3: 17
4: 336
Right 1046760722 8:118017265-118017287 AAAGCTTGTCTCAGCTGGCCTGG No data
1046760716_1046760721 20 Left 1046760716 8:118017217-118017239 CCTACCTCATTCTCCTTATACAT 0: 1
1: 0
2: 0
3: 17
4: 336
Right 1046760721 8:118017260-118017282 ATTAAAAAGCTTGTCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046760716 Original CRISPR ATGTATAAGGAGAATGAGGT AGG (reversed) Intronic
900686370 1:3950690-3950712 ATGCAAAAGGGGAATGGGGTGGG + Intergenic
902550822 1:17218704-17218726 AGGTCAAAGGAGAATGAGTTTGG + Intronic
902853806 1:19184357-19184379 TTGTGTAAGTAGAATTAGGTGGG - Intronic
903918072 1:26779086-26779108 ATTTTAAAGGAGTATGAGGTGGG + Exonic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904889201 1:33765732-33765754 ATAAATAGGGAAAATGAGGTTGG + Intronic
906769111 1:48468178-48468200 ATGGATAAAGAAAATGTGGTAGG + Intronic
906862720 1:49379027-49379049 CTGGATAAGGAAAATGTGGTAGG + Intronic
906903503 1:49864029-49864051 ATGGATAAAGAAAATGTGGTAGG + Intronic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910721314 1:90289373-90289395 ACCTAGAAGGAGAATGAGATTGG - Intergenic
911610708 1:99956603-99956625 AAATATTAGAAGAATGAGGTTGG - Intergenic
912847371 1:113087029-113087051 AGCTGTAAGGAGACTGAGGTAGG + Intronic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
916429446 1:164712965-164712987 ATGTGTAAGGATGATGAGTTGGG - Intronic
916937114 1:169640665-169640687 ATATATAAAGAGAATGACTTTGG + Intergenic
917039342 1:170786867-170786889 ATGGATAAAGATAATGGGGTTGG + Intergenic
918974518 1:191464810-191464832 ATACATGATGAGAATGAGGTTGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919342539 1:196331224-196331246 CTATATATGGAGAATAAGGTGGG + Exonic
919698000 1:200598934-200598956 ATGTATGAGTAGACTGAGGATGG - Intronic
920159848 1:203988159-203988181 ATGAAATAGGAGAGTGAGGTGGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
922019185 1:221686343-221686365 ATATATAAGGAGACTGAGTAAGG - Intergenic
922665764 1:227467169-227467191 ATAGATAAGGAGAATGGGATGGG - Intergenic
923501464 1:234568755-234568777 ATGTCTAGGGAGTATGAAGTAGG - Intergenic
1064508157 10:16056627-16056649 AGGTATATGGAAAATGAGGCTGG + Intergenic
1064821802 10:19344588-19344610 TTGTATAAGAAGAATGAATTAGG - Intronic
1065035120 10:21630211-21630233 ATGGATCATGAGATTGAGGTGGG + Intronic
1066537349 10:36406416-36406438 ATATATAAGGAGATTTATGTAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066644470 10:37591891-37591913 ATATATAAGGAGATTTATGTAGG + Intergenic
1066984542 10:42453754-42453776 AGGTATAAAGAGAATGAGATGGG + Intergenic
1068196372 10:53722366-53722388 GTGTAAAAGGATAATTAGGTTGG + Intergenic
1069652133 10:70057009-70057031 ATGTATATTGGGAATTAGGTTGG + Intronic
1070223000 10:74470319-74470341 ATGTATAAAGAAAATGTGGCTGG - Intronic
1072671922 10:97436725-97436747 TTATATAAGGAGAATCAGGCTGG + Intronic
1073446034 10:103580840-103580862 ATGTACAAAGAGAAGGGGGTAGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074088264 10:110225226-110225248 ATACATAAGGAAAATGAGGCTGG + Intronic
1074292948 10:112154624-112154646 ATGTTTAAGGATATTGGGGTAGG - Exonic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076653675 10:132007174-132007196 GTGTTTAAGGACAATGTGGTGGG + Intergenic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1079831258 11:25271509-25271531 ATTTATAAAGAGCATGAGGAAGG - Intergenic
1079896712 11:26128314-26128336 ATGAATAATGAGTATGAGGCTGG - Intergenic
1079918256 11:26398376-26398398 ATGAATGGAGAGAATGAGGTTGG + Intronic
1081071477 11:38615615-38615637 ATGTACAAGGAGATTAATGTTGG - Intergenic
1081244882 11:40752890-40752912 ATGTATAAAGAAAATGTGGTAGG + Intronic
1081710924 11:45214829-45214851 ATGTTTAAGGAAAAGCAGGTTGG + Intronic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083690138 11:64402940-64402962 GTGCACAAGGAGAGTGAGGTTGG - Intergenic
1084887618 11:72221335-72221357 AGGAAAAAGGAGATTGAGGTAGG + Intronic
1085375759 11:76059723-76059745 ATGTAAAAGGCAAATCAGGTGGG + Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086124049 11:83331655-83331677 GTGCATAAGTAGGATGAGGTAGG + Intergenic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1087684095 11:101244296-101244318 ATGTATAATGATAATAAGGGAGG + Intergenic
1088822969 11:113472297-113472319 AAGTATAAGGGGAAAGACGTGGG - Intronic
1090625299 11:128603232-128603254 ATGTGTATGGAGGATGAGGCTGG - Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091238202 11:134035482-134035504 ATGGATGAGGAAACTGAGGTAGG + Intergenic
1092786932 12:12035100-12035122 ATGGATAAAGAAAATGGGGTTGG - Intergenic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1092874936 12:12839750-12839772 ATTTATTAGGAAAATGAGTTAGG - Intergenic
1093674714 12:21925056-21925078 TTGTATAATGAAAATGATGTTGG - Intronic
1093870413 12:24284393-24284415 AGGTGTAAGGAGAATGTGGGAGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1096645233 12:53030108-53030130 GTGTCTTAGGAGACTGAGGTAGG + Intronic
1096645255 12:53030266-53030288 GTGTCTTAGGAGACTGAGGTAGG + Intronic
1097237395 12:57549759-57549781 AGGGATAAGGGGACTGAGGTGGG - Intergenic
1098029983 12:66243529-66243551 ATGGATATTGAGAAGGAGGTGGG - Intronic
1099295456 12:80823145-80823167 ATGTCCAGGAAGAATGAGGTAGG - Intronic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1101165003 12:102020274-102020296 AAGTAAAGGTAGAATGAGGTGGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102310443 12:111840913-111840935 AAGTATAAAAAGGATGAGGTTGG - Intergenic
1103840960 12:123863923-123863945 ATGTAAGAGAAGAATGAGGTAGG + Intronic
1105252569 13:18713159-18713181 ACCTAGAAGGAGAATGAGATTGG + Intergenic
1106578389 13:30997206-30997228 AGTTAGAAGGAGCATGAGGTTGG + Intergenic
1106900336 13:34349013-34349035 ATGTATAAGGTGTAGCAGGTAGG - Intergenic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1108479220 13:50850842-50850864 ATGGATAAAGAAAATGTGGTGGG + Intergenic
1108549237 13:51526716-51526738 AGGTATAAGGACAATTAGGGTGG + Intergenic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1110428450 13:75395954-75395976 ATTTATAAGCAGGATCAGGTTGG + Intronic
1114873853 14:26691005-26691027 ATGGATAGAGAGATTGAGGTGGG - Intergenic
1115510381 14:34132506-34132528 GGGATTAAGGAGAATGAGGTTGG - Intronic
1115574728 14:34699760-34699782 ATGTGTAAGGAGAAAGAAATTGG - Intergenic
1117112464 14:52473001-52473023 TTGTATAAGAAGATTAAGGTGGG + Intronic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118506809 14:66422564-66422586 ATGTTAAGGGAGAAGGAGGTTGG - Intergenic
1118701197 14:68434889-68434911 ATGGATAAAGAAAATGTGGTGGG - Intronic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1124603968 15:31157022-31157044 AGGTATTAGGAGGCTGAGGTGGG - Intronic
1127083453 15:55403307-55403329 ATGTAAAAAGAGCATTAGGTTGG - Intronic
1127183919 15:56457701-56457723 CTGTATCAGGAGGTTGAGGTAGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1134599198 16:15520125-15520147 ATGAATGAGGAAATTGAGGTCGG + Intronic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1137309754 16:47243634-47243656 AGGTATCAGAAGAATGAGGGAGG + Intronic
1138379517 16:56590361-56590383 ATGCATAGGGAGTAAGAGGTGGG + Intronic
1140210600 16:72966809-72966831 ATCTATAAGGAAAGAGAGGTGGG + Intronic
1140242221 16:73213430-73213452 ATGTGCAAGGAGAAAGAGATCGG + Intergenic
1141362405 16:83408122-83408144 ATGTGTCAGGAGAATGAGACCGG - Intronic
1143632031 17:8144990-8145012 ATGTCTGAGGAGAGTGAGATAGG + Exonic
1143742417 17:8964450-8964472 ATGAATCAGGAGACTGAGGCTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1148066624 17:44875597-44875619 AGCTATCAGGAGACTGAGGTGGG + Intronic
1150843773 17:68634285-68634307 ATCTATAAAGAAAAAGAGGTGGG - Intergenic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1156061090 18:33077170-33077192 CTGTATATGGATAATGAGTTGGG + Intronic
1158284127 18:55860287-55860309 ATGTATCAGGAGATTGGGGCGGG + Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158862807 18:61609499-61609521 ATTAAAAAGGAGCATGAGGTAGG + Intergenic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1162010056 19:7807667-7807689 AGGTAAAATGAGAATGAGGGCGG - Intergenic
1162550943 19:11357792-11357814 ACAGATAAGGAGACTGAGGTTGG - Intronic
1163099501 19:15085908-15085930 ATGGATAAAGAAAATGTGGTAGG - Intergenic
1164543804 19:29142537-29142559 ATGTGGAAGGAGAATAAGCTGGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1164801062 19:31077123-31077145 AAGTATAAAAATAATGAGGTGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166562122 19:43739903-43739925 GTGTAGAAGGCGAATGAGATGGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
926906332 2:17808963-17808985 AGCTATAAGGAGGCTGAGGTGGG + Intergenic
927000288 2:18787904-18787926 ATGTATGAGGAGAATGAGTCAGG + Intergenic
927893484 2:26766800-26766822 CTGTATAAGGAAACTGAGGTAGG + Intronic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929470105 2:42183041-42183063 AGGTATCAGGAGGCTGAGGTGGG + Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929997791 2:46839833-46839855 ATGTGGTAGAAGAATGAGGTGGG + Intronic
930436118 2:51344460-51344482 ATGTACTAAGAGATTGAGGTGGG + Intergenic
930635586 2:53802144-53802166 ATGTATCAGGAGACAGAGATAGG - Intronic
930949501 2:57122020-57122042 ATGTACAAGGAGATTAATGTTGG - Intergenic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932877040 2:75463619-75463641 ATGCATAAGGAGATGCAGGTTGG - Intergenic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
933650067 2:84843382-84843404 ATGTGAAAGGAGAAAGGGGTTGG - Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933815038 2:86059897-86059919 GTGTATATGGAGAGTGGGGTTGG + Intronic
934487295 2:94727169-94727191 ACCTAGAAGGAGAATGAGATTGG + Intergenic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
938887565 2:135668120-135668142 TTGGATTAGGAGAATGATGTGGG + Intronic
939131080 2:138236778-138236800 ATTTATAAAGAAAAAGAGGTGGG - Intergenic
939701713 2:145400552-145400574 TTGCATAGGGAGACTGAGGTTGG - Intergenic
940177012 2:150889639-150889661 ATGTAGATGGACTATGAGGTTGG - Intergenic
940385401 2:153065487-153065509 CTCTATTAGGAGATTGAGGTAGG + Intergenic
941842800 2:170105867-170105889 AAGTATAAAGACCATGAGGTGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
943573532 2:189602882-189602904 ATTTGAAAGGAGAAGGAGGTTGG - Intergenic
943854897 2:192777064-192777086 AAGTATGAGGAGAATGAGATGGG - Intergenic
943902673 2:193461000-193461022 ATTTAAAAGGAGAATAGGGTGGG + Intergenic
943963592 2:194300341-194300363 ATATATAAGCAAAAAGAGGTAGG - Intergenic
944256267 2:197626263-197626285 ATGTAAAAGGAGAATAAGCATGG + Intronic
944291887 2:198017344-198017366 ATGTCTGAGGAGACTCAGGTTGG + Intronic
945413535 2:209542144-209542166 ATGTACAAGGAGATTGATGTTGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946321604 2:218957963-218957985 AACTATGAGGAGAATGAGTTTGG + Intergenic
946436068 2:219655431-219655453 TTGTAAAAGGAGAATAAAGTGGG + Intergenic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
947728634 2:232416290-232416312 GTGGACAAGGAGTATGAGGTGGG - Intergenic
947740585 2:232483100-232483122 GTGGACAAGGAGTATGAGGTGGG - Exonic
948046430 2:234949217-234949239 ATGTATAAAGACAGTGTGGTAGG - Intergenic
1168782289 20:503389-503411 ATGTAGAAAGAGAACTAGGTTGG - Intronic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169962684 20:11179302-11179324 ATGTATAAGGATAGTCAAGTTGG - Intergenic
1171939376 20:31310746-31310768 ATGTAAAAGGAGATTAACGTTGG - Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174713235 20:52728975-52728997 ATTTATATGGAGGGTGAGGTGGG - Intergenic
1176838093 21:13813049-13813071 ACCTAGAAGGAGAATGAGATTGG + Intergenic
1176905920 21:14501045-14501067 ATGTATCTGTAGACTGAGGTGGG + Intronic
1177622438 21:23613554-23613576 ATTAATAAGTATAATGAGGTTGG - Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1179423074 21:41251465-41251487 ATGTATAAGGGTGATGTGGTAGG - Intronic
1179460314 21:41530170-41530192 ATTTCTCAGGAGAAGGAGGTGGG - Intronic
1183900456 22:41002112-41002134 AAGTATCGGGAGATTGAGGTGGG - Intergenic
1183970207 22:41471499-41471521 AAATATATGGTGAATGAGGTAGG - Intronic
1184863243 22:47188804-47188826 ACAAATAAGGACAATGAGGTTGG + Intergenic
949195428 3:1300279-1300301 ATATAAAAGCAGAATGCGGTCGG - Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949467900 3:4362432-4362454 ATTTATAAGGTGAAGGACGTTGG - Intronic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
950271409 3:11618896-11618918 ATGTAAAAAGAGAGAGAGGTGGG - Intronic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
952387237 3:32850901-32850923 ATGTCTCATTAGAATGAGGTGGG - Intronic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
954075609 3:48177163-48177185 ATGTATAAGGAGTGTGGGTTAGG - Intronic
954475400 3:50739681-50739703 AAGTATAAAGAGAATGGGCTTGG + Intronic
954849428 3:53587809-53587831 ATGTAAAAGGAGAATCTGGTAGG + Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
958558086 3:95705407-95705429 ATGTAAAAAGAACATGAGGTTGG + Intergenic
958801033 3:98756116-98756138 ATTTTTAAGGAGACTGAGCTGGG + Intronic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
962802294 3:138900774-138900796 ATGTGTAAGGAGGGAGAGGTTGG + Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
966531983 3:180991263-180991285 AGGTATCATGAGAATGAGGAAGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
969618723 4:8268405-8268427 ATGTCTGGGGAGGATGAGGTGGG - Intergenic
969832987 4:9813504-9813526 ATATATAAAGAGAATGTGATGGG - Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
971641497 4:29138883-29138905 ATGTATGAGGAGCATGTGTTAGG - Intergenic
972123194 4:35731553-35731575 GTGTATAGGGAAAATGATGTAGG - Intergenic
973215776 4:47667636-47667658 ATTTATAAGGAGGCTGATGTTGG + Intronic
973797098 4:54438677-54438699 ATGGATAAAGAAAATGTGGTGGG - Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974278434 4:59758823-59758845 ATGTTCAGGAAGAATGAGGTAGG + Intergenic
976292015 4:83429001-83429023 AAGTATATAGAGAATAAGGTAGG - Intronic
976600039 4:86929638-86929660 ATCTAGAAGGAGAGTGTGGTAGG - Intronic
978234642 4:106443740-106443762 ATGTATAGGAAGAATTAGGCTGG - Intergenic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
981032739 4:140141889-140141911 ATGTATAAAGAGAAAAAAGTTGG - Intronic
981064395 4:140466851-140466873 ATGTATCACGAAAATGGGGTTGG + Intronic
981493098 4:145362199-145362221 ATGTACAAGGAGATTAATGTTGG + Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
983112731 4:163772916-163772938 ATATGGAAGGAGAAGGAGGTGGG + Intronic
983958197 4:173721568-173721590 ATATGTAAGAAGAATGTGGTTGG + Intergenic
986229696 5:5852077-5852099 ATGCAGCAGGAGAATAAGGTAGG - Intergenic
987058721 5:14221295-14221317 ATGTATAAGAAGATTAATGTTGG + Intronic
987256161 5:16154002-16154024 ATGTATCAGGACAACGAGATAGG + Intronic
987855231 5:23412198-23412220 ATGTATACAGAGAAAGAGGGAGG + Intergenic
987935639 5:24460940-24460962 ATGTGTAAGGAAAATGAGAGAGG + Intergenic
989252150 5:39329909-39329931 ATGTATAATAATAATGAGTTTGG + Intronic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991609778 5:68437998-68438020 GAGTATAAGGAGAAAGATGTGGG + Intergenic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
993745173 5:91588400-91588422 ATGTTTGGGGAGGATGAGGTGGG - Intergenic
994801010 5:104375745-104375767 ATGTAGAAAGAAAATGAGATAGG + Intergenic
995164491 5:109023210-109023232 TTGTATGTGGAGAATGAGGCAGG + Intronic
995214309 5:109577402-109577424 ATGTACAAGGAGATTGATGTTGG - Intergenic
995279810 5:110321070-110321092 AAATATAAGCAGAATGAGATTGG + Intronic
995291541 5:110461959-110461981 ATGTACAAGGAGATTAATGTTGG + Intronic
995394996 5:111678076-111678098 ATGTAGTATGAGAATAAGGTAGG - Intronic
997348495 5:133211457-133211479 AAGTATAAGGTGGCTGAGGTGGG - Intronic
997354925 5:133256245-133256267 ATTTAGAAGGAGAATAATGTGGG - Intronic
997593513 5:135091042-135091064 ATGTATATAGAGGAGGAGGTAGG + Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
998981526 5:147708471-147708493 ACGTAGAAGGAGAAACAGGTTGG + Intronic
1001193316 5:169650388-169650410 ATATATAAGGAAACTGAGGAAGG - Intronic
1001637746 5:173224495-173224517 AGAAATAAGGAAAATGAGGTGGG - Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1003806340 6:9729459-9729481 ATGAATCAGGATAATGAGATAGG + Intronic
1008310416 6:49963854-49963876 ACATATTTGGAGAATGAGGTGGG + Intronic
1009300773 6:62016203-62016225 ATTTAATAGTAGAATGAGGTAGG + Intronic
1010348359 6:74840297-74840319 CTGTATAGGGAGCATGAGGCTGG - Intergenic
1010534637 6:77011931-77011953 ATGTTCAGGAAGAATGAGGTAGG - Intergenic
1010887553 6:81263177-81263199 ATGTCCAGGGAGAAAGAGGTAGG + Intergenic
1011302270 6:85888892-85888914 ATGGATAAAGAAAATGTGGTGGG - Intergenic
1012515540 6:100054744-100054766 ATGGATAAAGAAAATGTGGTAGG - Intergenic
1012693309 6:102345759-102345781 ATATATAAGGAGTAAGAAGTTGG + Intergenic
1012696646 6:102392117-102392139 ATGTTTAATGAGAATGAAGAAGG - Intergenic
1013541211 6:111111611-111111633 ATATATAACGACAATTAGGTAGG - Intronic
1013670456 6:112396702-112396724 ATAAGAAAGGAGAATGAGGTTGG - Intergenic
1014540381 6:122668766-122668788 ATATATAAGAAGAAAGAGTTTGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1016810718 6:148258777-148258799 ATGTATAAGGGGAATGAAAGAGG - Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017582757 6:155884530-155884552 GTGTATAAGGAGAAAGATGGTGG - Intergenic
1023850020 7:44145316-44145338 ATGAATGTGGAGGATGAGGTGGG - Intronic
1024019645 7:45354708-45354730 ACGTATAAGGAAAAGGATGTTGG + Intergenic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026095730 7:67345091-67345113 GTGCATTAGGAGAATGGGGTGGG + Intergenic
1026275659 7:68873507-68873529 ATGTAGATTGAGATTGAGGTTGG + Intergenic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1028201599 7:87968424-87968446 ACGAATCAGGAGACTGAGGTAGG + Intronic
1028721872 7:94042174-94042196 ATGATTAAAGAGAATGTGGTAGG - Intergenic
1030176852 7:106662573-106662595 ATGCATAAGTAGAATGACGAAGG + Intergenic
1030336475 7:108333243-108333265 ATATATGATGAGAAAGAGGTAGG - Intronic
1030690025 7:112522812-112522834 ATGCATAAGAAGCAAGAGGTTGG - Intergenic
1030879435 7:114858879-114858901 ATGAATAAGTAGGATGAGCTTGG + Intergenic
1031713086 7:125073667-125073689 ATAGATAAAGAAAATGAGGTTGG + Intergenic
1035978423 8:4339775-4339797 ATGCTTTGGGAGAATGAGGTGGG + Intronic
1035993838 8:4523108-4523130 ATGTATAATGAGAATTATTTTGG - Intronic
1036469189 8:9035633-9035655 TTGTATAAGGAGATTAATGTTGG + Intronic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037834504 8:22208177-22208199 AAGTATCAGGAGAATGGGCTGGG - Intronic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1039480440 8:37869289-37869311 GGGTAAAAGGAGCATGAGGTAGG + Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1040650029 8:49437174-49437196 ATGTATTTGGCGAATGAGATTGG + Intergenic
1040671045 8:49691203-49691225 ATGTATAGGGAGGATTAGGTGGG + Intergenic
1041007909 8:53513906-53513928 ATTTAGAAAGAGAATGAGTTAGG + Intergenic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042695874 8:71554886-71554908 ATGTACAAGCAGTATGTGGTGGG + Intronic
1044012676 8:87013825-87013847 AGGTATAAGGAGAAAAAGTTCGG - Intronic
1044086887 8:87953393-87953415 ATGTACAAAGACAAAGAGGTTGG - Intergenic
1044642929 8:94404072-94404094 ATGTGTAATGGGAATGAGGTAGG - Exonic
1045976460 8:108134900-108134922 AATTACAAGGAGAATGAGTTTGG + Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1047362790 8:124184378-124184400 AGGTGGAAGAAGAATGAGGTTGG + Intergenic
1047540736 8:125763270-125763292 TTGTATAAGGTGAGAGAGGTGGG - Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1048602556 8:135933461-135933483 AGGGATAAAGAGAATGAGTTTGG + Intergenic
1050644604 9:7705512-7705534 ATGAATAAGGACAAAGATGTTGG + Intergenic
1050776533 9:9269618-9269640 ATGTATAAAGAAAATGTGGTCGG + Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1053670513 9:40357261-40357283 ACCTAGAAGGAGAATGAGATTGG - Intergenic
1053920298 9:42983526-42983548 ACCTAGAAGGAGAATGAGATTGG - Intergenic
1054381629 9:64497245-64497267 ACCTAGAAGGAGAATGAGATTGG - Intergenic
1054514100 9:66019039-66019061 ACCTAGAAGGAGAATGAGATTGG + Intergenic
1055258174 9:74398610-74398632 GTGTTTCAGGAGACTGAGGTGGG + Intergenic
1056586347 9:87929902-87929924 AGGTGTAAGGAGAAAGGGGTGGG - Intergenic
1059621925 9:116015174-116015196 ATGTATAAATAGAATGACTTTGG + Intergenic
1059756425 9:117297837-117297859 GGGTAGAAGGAGGATGAGGTTGG - Intronic
1060707301 9:125815848-125815870 ATCTACAATGAGAAGGAGGTAGG - Intronic
1061775535 9:132960746-132960768 ATGTTTTGGGAGACTGAGGTGGG - Intronic
1186096161 X:6104831-6104853 ATGTATATGGAGTTAGAGGTAGG + Intronic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1186729255 X:12391184-12391206 ATGAATAAGGAGATGGGGGTGGG - Intronic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1186928747 X:14363855-14363877 ATGTATATGAAGTATGATGTAGG + Intergenic
1187515239 X:19963675-19963697 ATGTAAAAGAACTATGAGGTGGG + Intronic
1188340766 X:28998455-28998477 ATGTTTATGGAGAGGGAGGTGGG + Intronic
1190381640 X:49844863-49844885 AAGTATAATGAGACTGAGGCTGG + Intergenic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1191148207 X:57190858-57190880 ATGTATAAAGAAAATGTGGGGGG - Intergenic
1192310173 X:70005089-70005111 ATGTATCAGGAAAAAAAGGTGGG + Intronic
1192507348 X:71696858-71696880 ATGTACAAGGCGTTTGAGGTCGG + Intergenic
1192508099 X:71702820-71702842 ATGTACAAGGCGTTTGAGGTCGG + Intergenic
1192518597 X:71778733-71778755 ATGTACAAGGCGTTTGAGGTCGG - Intergenic
1192519348 X:71784694-71784716 ATGTACAAGGCGTTTGAGGTCGG - Intergenic
1193211400 X:78810861-78810883 ATGTCCAGGAAGAATGAGGTAGG + Intergenic
1193841760 X:86416030-86416052 ATTTATATTGAGAAAGAGGTAGG + Intronic
1196827732 X:119754096-119754118 ATGACTAAGGAGAAAGGGGTGGG - Intergenic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1201782724 Y:17741265-17741287 CTGTATAATGAGAATTAAGTTGG + Intergenic
1201818829 Y:18164723-18164745 CTGTATAATGAGAATTAAGTTGG - Intergenic