ID: 1046762426

View in Genome Browser
Species Human (GRCh38)
Location 8:118035183-118035205
Sequence CTGAGGGTTAAGTTACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046762426_1046762432 21 Left 1046762426 8:118035183-118035205 CCATGGTGTAACTTAACCCTCAG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1046762432 8:118035227-118035249 TGCTAGCCTCACTCGCACACAGG No data
1046762426_1046762430 -4 Left 1046762426 8:118035183-118035205 CCATGGTGTAACTTAACCCTCAG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1046762430 8:118035202-118035224 TCAGGCTGTCCTACTCAATGTGG No data
1046762426_1046762434 29 Left 1046762426 8:118035183-118035205 CCATGGTGTAACTTAACCCTCAG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046762426 Original CRISPR CTGAGGGTTAAGTTACACCA TGG (reversed) Intronic
903915130 1:26758269-26758291 TTGATGGCTAAGTTATACCATGG - Intronic
907269588 1:53283070-53283092 TTGAGGATTAAGTTCCAACATGG - Intronic
909885186 1:80932860-80932882 CTAAGGCTGAAGTTACACAATGG - Intergenic
909913914 1:81294288-81294310 GTGAGGGTTAAGTTACAAGTGGG + Intergenic
910016863 1:82535566-82535588 TTGAAGGTTGAGTTTCACCAGGG + Intergenic
915878683 1:159642569-159642591 CTGAGGGATAAGATTCATCATGG - Intergenic
919733847 1:200932114-200932136 CTGAGGCTTGGCTTACACCACGG + Intergenic
921125393 1:212173159-212173181 TTGAGGATTAAGTTTCAACATGG + Intergenic
1067713507 10:48669271-48669293 CAGAGGGAGAATTTACACCATGG - Intergenic
1067856079 10:49794689-49794711 CTGATGGGTAAATTACATCACGG - Intergenic
1070451126 10:76558100-76558122 ATGAGGGTTTGGTTGCACCAGGG + Intronic
1071480637 10:86062351-86062373 CTGGGGGGTGAGTTACACCCTGG - Intronic
1073925691 10:108512527-108512549 CTGACTGCTAAGTTACAACAAGG - Intergenic
1079186654 11:18244356-18244378 CCCAGAGTTAAGTTACACCCTGG + Intronic
1080128917 11:28770312-28770334 CTGTGGGTCAAGTTTCACCTGGG - Intergenic
1081264529 11:41003826-41003848 CTGAGGGGTACCTTACATCAGGG + Intronic
1085336603 11:75701387-75701409 CTTAGGGCTAAGTCACACCAGGG - Intergenic
1090548913 11:127797481-127797503 TTGAAGGTCAAGTTTCACCAGGG - Intergenic
1090744541 11:129695721-129695743 CTGAGGGTGCAGTTCCACCACGG - Intergenic
1095676191 12:44921511-44921533 CTGAGGGTCAAGGTACACAGAGG - Intronic
1099509797 12:83519749-83519771 CTGAGGTTTAAGTTTCACTTGGG + Intergenic
1099775603 12:87124292-87124314 TTGAAGGTCAAGTTTCACCAGGG - Intergenic
1100872311 12:98923006-98923028 CTGAGGATTGAATTTCACCATGG - Intronic
1102393547 12:112569091-112569113 CTGAGGGTTACTATACACCAGGG + Intergenic
1104118150 12:125770315-125770337 CTGTGGGTGTATTTACACCAAGG + Intergenic
1104630507 12:130397520-130397542 CTGAGGGTTCAGGTACAGCAAGG - Exonic
1106343136 13:28850325-28850347 CTCAGGGTTCAGATACAACATGG + Intronic
1108961548 13:56238515-56238537 CTGAAAGTCAAGTTTCACCAGGG + Intergenic
1120493347 14:85204309-85204331 TTGAGGGTAGAGTTTCACCAAGG - Intergenic
1126953592 15:53910240-53910262 CTGGGGGTTAAGTGACAACATGG - Intergenic
1135246141 16:20858683-20858705 CTGGGGGTTAAGTGACAACATGG + Exonic
1137661714 16:50212888-50212910 ATAAGGGTTAAGTTAGATCACGG - Intronic
1137946470 16:52737550-52737572 CTGTGTGTTAAGGCACACCAGGG - Intergenic
1139641663 16:68296178-68296200 CTGAGGGTTAATGTACCTCAGGG + Intronic
1140280619 16:73551479-73551501 CTGTGGGTTATGTTTAACCAAGG + Intergenic
1140528168 16:75641257-75641279 CTGAGGTTTACTTTAGACCAGGG - Intronic
1141065685 16:80911912-80911934 AGGAGGGTTTAGTTACACAAAGG + Intergenic
1147837630 17:43346197-43346219 CTGGGGGTTAAGTGACAACATGG - Intergenic
1153234439 18:2972090-2972112 CTTTGGGTTAACTTCCACCATGG - Intronic
1153616411 18:6938982-6939004 CTGAGGATTAAATTTCACTATGG + Intergenic
1155676414 18:28434695-28434717 CTGAGGTTTAGGGTACACCCAGG + Intergenic
1156700353 18:39817636-39817658 CTCAGTGTTAAGTGAGACCATGG + Intergenic
1158191617 18:54835269-54835291 TAGAGGCTTAAGTTACTCCAAGG - Intronic
1158291206 18:55946419-55946441 TTGAGGGTTAAGATACATGAGGG - Intergenic
1158842438 18:61402298-61402320 CTGAGGCCCAAGTTACAGCAGGG - Intronic
1158999503 18:62958918-62958940 CTGAGATTTAAGTTACATCTTGG - Intronic
1159133107 18:64303787-64303809 CTGAAGGTAAATTTACACCGTGG + Intergenic
1160606157 18:80051021-80051043 CTGAGGATTAACTGACATCAGGG - Intronic
1163423856 19:17230093-17230115 CTGAGGGTTGAGTGAGACCATGG - Intergenic
925781401 2:7385299-7385321 CTGATGGTTAAGTTTCCCCAGGG - Intergenic
928500903 2:31894294-31894316 CTGAGGTATAAGTTCCATCAAGG + Intronic
928627609 2:33156542-33156564 GTGAGGGTTAAATGACAGCATGG + Intronic
929109366 2:38393462-38393484 GAGAAGCTTAAGTTACACCATGG + Intergenic
930262150 2:49160352-49160374 CAGAGGGAGAGGTTACACCATGG - Intergenic
937089917 2:119199310-119199332 CAGAGGGAGAAGTTAAACCAAGG + Intergenic
938173895 2:129106659-129106681 CTGTGGGTTAACTGAAACCATGG - Intergenic
940776049 2:157884858-157884880 CAGAGTGCTAACTTACACCATGG + Intronic
943441960 2:187935855-187935877 TTGAAGGTTCAGTTTCACCAGGG + Intergenic
945726550 2:213477226-213477248 TTGAAGGTCAAGTTTCACCAGGG + Intronic
948494513 2:238338266-238338288 ATAAGGGTTACATTACACCAAGG - Intronic
1169344928 20:4822505-4822527 CTGAGGGTTCTGTTTCACCTCGG - Intronic
1173475707 20:43357754-43357776 CTGGGGGTCAAATTACAACATGG + Intergenic
1175811402 20:61860353-61860375 CTGAGGGCTGAGCTACACCTCGG + Intronic
1179194677 21:39153966-39153988 CTGGGGATTAAGTTTCAACACGG - Intergenic
1179281650 21:39939030-39939052 CTGAGGGTTCAGCTGCATCAGGG - Intergenic
1180025862 21:45161686-45161708 CTGAAGGTGGAGTTTCACCAGGG - Intronic
1180045867 21:45304864-45304886 CTGGGGATTAAGTTTCAACATGG - Intergenic
1182288925 22:29264290-29264312 TTGAAGGTTACGCTACACCAGGG + Intronic
1185017664 22:48354255-48354277 CTGAGGGTTCACTTCCCCCAGGG + Intergenic
952114982 3:30168278-30168300 CTTAGTGTAAAGTTACACCTTGG + Intergenic
953043177 3:39272966-39272988 CTGCTGGTTAATTTATACCATGG - Intronic
958884304 3:99708817-99708839 CTGAGGGTGAAATTAGACCCGGG + Intronic
960825580 3:121780145-121780167 CTGAGAGTCAGGTGACACCAAGG - Intronic
966838573 3:184069036-184069058 TTGAAGGTTGAGTTTCACCAGGG - Intergenic
968170665 3:196507225-196507247 TTGAAGGTTGAGTTTCACCAGGG + Exonic
971834661 4:31748106-31748128 TTGAGGGTGAGGTTTCACCAGGG + Intergenic
974495235 4:62617023-62617045 CTGATAGTAAAGTTACACTATGG - Intergenic
977749890 4:100596607-100596629 CTGAGGTATGAGTTACCCCAAGG + Intronic
978491058 4:109312853-109312875 TTGAAGGTTGAGTTTCACCAAGG - Intergenic
978492095 4:109320278-109320300 TTGAAGGTCAAGTTTCACCAGGG - Intergenic
981454561 4:144938477-144938499 CTGAAGTTCAAGCTACACCATGG + Intergenic
983320420 4:166189976-166189998 CTGAAGGTCAAGTTTCACTAGGG + Intergenic
983354842 4:166643889-166643911 CTGGGGGTGAAGTTTCCCCATGG + Intergenic
987097379 5:14561811-14561833 TTGAGGGTTAGGTTTCAACATGG + Intergenic
987875398 5:23674834-23674856 TTGAAGGTGAAGTTTCACCAGGG - Intergenic
989164522 5:38421653-38421675 GTGAAGGTGAAGTTACACCTGGG + Intronic
995990986 5:118239648-118239670 AAGAGGGTTAAGTTACAACATGG - Intergenic
996277863 5:121689470-121689492 TTGAGGTTTTAGTTACATCAAGG - Intergenic
997486608 5:134236203-134236225 CTGATGGTTTAGTTACATCTTGG + Intergenic
1002390441 5:178907473-178907495 CTGGGGGTTAAGTGACAACATGG + Intronic
1003757483 6:9137877-9137899 CTGAGGGTGAAGCCAAACCATGG - Intergenic
1005717914 6:28569204-28569226 CTGTGGGTCAGGTGACACCAAGG - Intergenic
1008927303 6:56900523-56900545 CTGATGGTGAACTTCCACCACGG + Intronic
1012857581 6:104520789-104520811 TTGAAGGTTAAATTAGACCATGG - Intergenic
1016501841 6:144728931-144728953 GTGAGGGTTAAGCTACACTTTGG + Intronic
1019214153 6:170432237-170432259 CTGATGGGCAAATTACACCAAGG - Intergenic
1023803048 7:43851497-43851519 CTGAAGGTTGAGTTTCACCAGGG - Intergenic
1023934446 7:44729539-44729561 TTGAAGGTCAAGTTTCACCAGGG - Intergenic
1024887931 7:54166437-54166459 CTGAGGGGCAAATTACACCAAGG - Intergenic
1028529119 7:91818355-91818377 CTGAGGGATGAGTTACTTCATGG - Intronic
1030722679 7:112887310-112887332 TTGGGGGTTAAGTTACACTTTGG - Intronic
1031748355 7:125535773-125535795 TTGAAGGTTGAATTACACCAAGG + Intergenic
1038158164 8:25010777-25010799 CTGGGGGTAAAATGACACCAAGG + Intergenic
1038943708 8:32333894-32333916 CTGAGGGTTGACATACACCAAGG - Intronic
1039831917 8:41222159-41222181 CTTTGGGTTAAGTGACATCAGGG + Intergenic
1040780749 8:51106698-51106720 CTGAGGTTTGTGGTACACCAGGG - Intergenic
1040945491 8:52880822-52880844 CTGATGATTAAATTACAGCAAGG - Intergenic
1041461791 8:58119497-58119519 CTGGGGGTTAGGTTTCAACATGG + Intronic
1042264331 8:66892750-66892772 CTGAAGGTTGGGTTCCACCAGGG + Intronic
1043649840 8:82577810-82577832 CTGTGGGTTAATTAACAGCATGG + Intergenic
1046762426 8:118035183-118035205 CTGAGGGTTAAGTTACACCATGG - Intronic
1049010280 8:139882758-139882780 CTGCTGGATAAGTTACTCCAGGG - Intronic
1050282026 9:4060443-4060465 CTGGGGATTAAGTTTCAACACGG - Intronic
1050666975 9:7949972-7949994 CTGATGGGTAAGGTAGACCATGG + Intergenic
1051395037 9:16610636-16610658 ATGAGAGTTAAGTTACCACAGGG - Intronic
1052892791 9:33719738-33719760 CTGAGGGTGCAGTTCCACCATGG - Intergenic
1053550119 9:39068689-39068711 CTGAGAGTTCAGGTACACGAAGG - Intergenic
1053814231 9:41888795-41888817 CTGAGAGTTCAGGTACACGAAGG - Intergenic
1054616365 9:67298645-67298667 CTGAGAGTTCAGGTACACGAAGG + Intergenic
1055517322 9:77046494-77046516 CTGAGGGCTATGCTGCACCACGG + Intergenic
1058487724 9:105458748-105458770 CTGAAGGTCAGGTTTCACCAGGG + Intronic
1059846944 9:118290383-118290405 TTGAGGATTAAGTTTCAACATGG + Intergenic
1060812241 9:126616311-126616333 CTGAGGTTTGGGTTATACCAGGG - Intronic
1060885060 9:127145549-127145571 CCCAGGGTTAAGTAACTCCAAGG + Intronic
1187550642 X:20301360-20301382 CTGTGGGTTAAGTTAAGCCATGG - Intergenic
1188876706 X:35439777-35439799 CTGATGGTCAAATTACATCAAGG - Intergenic
1189697362 X:43678110-43678132 ATGAGGGTACAGATACACCATGG + Intronic
1191730269 X:64326466-64326488 CTTAGGGATAAGTTTAACCAAGG + Intronic
1193889652 X:87029028-87029050 CTGAGGTTTAAGATTCCCCATGG + Intergenic
1194082267 X:89483476-89483498 TTGAAGGTCAAGTTTCACCAAGG + Intergenic
1197342189 X:125287546-125287568 CTGAAGGTGGAGTTTCACCAGGG - Intergenic
1197892161 X:131278670-131278692 CAGAGGGTTAAGTTCTTCCACGG + Exonic
1200434935 Y:3139667-3139689 TTGAAGGTCAAGTTTCACCAAGG + Intergenic