ID: 1046762428

View in Genome Browser
Species Human (GRCh38)
Location 8:118035199-118035221
Sequence CATTGAGTAGGACAGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046762428_1046762434 13 Left 1046762428 8:118035199-118035221 CCCTCAGGCTGTCCTACTCAATG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data
1046762428_1046762432 5 Left 1046762428 8:118035199-118035221 CCCTCAGGCTGTCCTACTCAATG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1046762432 8:118035227-118035249 TGCTAGCCTCACTCGCACACAGG No data
1046762428_1046762436 23 Left 1046762428 8:118035199-118035221 CCCTCAGGCTGTCCTACTCAATG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1046762436 8:118035245-118035267 ACAGGAAGCTTGGAATTTGGAGG No data
1046762428_1046762435 20 Left 1046762428 8:118035199-118035221 CCCTCAGGCTGTCCTACTCAATG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1046762435 8:118035242-118035264 CACACAGGAAGCTTGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046762428 Original CRISPR CATTGAGTAGGACAGCCTGA GGG (reversed) Intronic
900395826 1:2452880-2452902 CCTAGAGGAGGACAGCCTGGAGG + Intronic
901166689 1:7226322-7226344 CATTGCCTGGAACAGCCTGAAGG - Intronic
902975501 1:20085359-20085381 CAAGGAGCAGGACAGCCTGTCGG - Intronic
903864744 1:26389857-26389879 CACAGAGGAGGACAGCCTCAGGG + Intergenic
905008162 1:34728145-34728167 TGTGGAGTAGGACAGCTTGATGG - Intronic
910761011 1:90731016-90731038 CATTGAATAGCAAAGCCTGGTGG + Intergenic
915268566 1:154735588-154735610 CCTTGAGTAGCACAGGCTGGTGG + Intronic
917739501 1:177948625-177948647 TATTTAGTAGGACAGCCTTAGGG - Intronic
919097653 1:193057801-193057823 CATGGAGGAGCACAGCCAGAAGG - Intronic
921307774 1:213814259-213814281 CTTGGAGCAGGACAACCTGAGGG + Intergenic
1064279037 10:13934124-13934146 CATTGACTATGACAGCATTAAGG + Intronic
1083663780 11:64264046-64264068 CATTAAGCACGTCAGCCTGATGG + Exonic
1087769037 11:102186991-102187013 CACTGAATAGGTCAGACTGAGGG + Intronic
1088720876 11:112590734-112590756 CTTTGAGGAGGACTGTCTGAGGG + Intergenic
1089019877 11:115202312-115202334 CATTGAGTGTGACAGACTGGGGG + Intronic
1089602651 11:119624972-119624994 CATCCAGGAGAACAGCCTGATGG - Intronic
1092955901 12:13549517-13549539 CAGTGAGCAGGGCAGCCTCAAGG - Exonic
1094677651 12:32636744-32636766 CACTGAGTAGCACTACCTGAAGG + Intronic
1097260702 12:57718467-57718489 CGTGGAGCAGGACAGGCTGACGG + Intronic
1098789207 12:74799263-74799285 CATTAAGTAGAACAGTATGAAGG + Intergenic
1101226331 12:102691567-102691589 CATTGTGTGGGAAAGACTGAGGG - Intergenic
1104628075 12:130376158-130376180 CATTGTGTTGGACAGCCTAAGGG - Intergenic
1105012405 12:132764526-132764548 GATTGACCAGGACAGCCTCACGG - Intergenic
1105305259 13:19164168-19164190 CATTGGGCATGACTGCCTGAGGG - Intergenic
1105321343 13:19325071-19325093 TGTTGAGTAGGAGAGCATGAAGG + Intergenic
1106017364 13:25882388-25882410 CAATGAGTAGGACAGCGCCATGG + Intronic
1110251995 13:73390656-73390678 CATGGAATAGCACAGCATGATGG + Intergenic
1118140618 14:63077095-63077117 TATCGACTGGGACAGCCTGAAGG + Intronic
1120176205 14:81295943-81295965 CATAGAGTAAGACTGCTTGAAGG - Intronic
1121072644 14:91038500-91038522 CATTGAGTTTGGAAGCCTGAAGG - Intronic
1122287026 14:100658335-100658357 CCTGGAGCTGGACAGCCTGAGGG + Intergenic
1122662828 14:103309459-103309481 CCTTGAGAAGGTCAGTCTGAGGG + Intergenic
1122864009 14:104595414-104595436 CATGGAGCAGGACAGCCTTTGGG + Intronic
1123183642 14:106492849-106492871 CATGGTGTAGGTGAGCCTGAGGG + Intergenic
1202936571 14_KI270725v1_random:93738-93760 CATTGAGTGGAACAGAGTGAAGG - Intergenic
1128760793 15:70214932-70214954 CAGTGAGCAGGCCAGCCTGCAGG + Intergenic
1131677253 15:94683061-94683083 CATGGCGTAGGGAAGCCTGAGGG - Intergenic
1132809585 16:1791124-1791146 CATTGAGGAGCAGAGCCTGTGGG - Exonic
1133118983 16:3594901-3594923 CACTGAGTGGGACAGGCTGCGGG + Intronic
1133553619 16:6883597-6883619 CACAGAGTAGAACAGCTTGAGGG - Intronic
1137720632 16:50625505-50625527 CATGGAGGAGGACAGCCGGCAGG + Exonic
1137802992 16:51278023-51278045 CAGTGAGGAGGACAGCATGCTGG - Intergenic
1139112694 16:63910883-63910905 CATTGACTTGGACAACCTAAAGG + Intergenic
1143057672 17:4174380-4174402 CTTGGAATAGGAAAGCCTGAAGG + Intronic
1144637663 17:16920603-16920625 CACTGAGTTGAACAGCCTGGTGG + Intergenic
1153055553 18:942593-942615 CAGTGAGAAGAACAGCCAGAAGG + Intergenic
1155837571 18:30605236-30605258 CATTGATTAGAACAGCCTGCGGG - Intergenic
1156087301 18:33421345-33421367 CATTGATGAAAACAGCCTGAGGG - Intronic
1164793747 19:31009485-31009507 CTCTGAATAGGGCAGCCTGATGG + Intergenic
1166015774 19:39978293-39978315 GATTGAGTAGGAAAGGCTGACGG + Intronic
925010084 2:477886-477908 CATGGAGCAGGACAGACAGATGG + Intergenic
926321963 2:11754708-11754730 CACTGAGGATGACAGCCTGGTGG + Intronic
927208753 2:20626113-20626135 CATTGTGTAGGCCAGCCTCTCGG - Intronic
931266814 2:60667806-60667828 CAAAGAGTAGGATAGGCTGATGG + Intergenic
934771611 2:96911235-96911257 CAGTGAGGGGGACAGCCTGATGG + Intronic
941866820 2:170344041-170344063 TATTTAGTGGGGCAGCCTGAGGG - Intronic
942426250 2:175863669-175863691 CTGTGACCAGGACAGCCTGATGG - Intergenic
942701017 2:178710573-178710595 CATTTTGTAGTATAGCCTGAAGG - Intronic
945623716 2:212173430-212173452 CAAAGAGAAGGTCAGCCTGAAGG + Intronic
946974961 2:225138553-225138575 AATTGGGTAGGAGAGCCTCAAGG + Intergenic
948482424 2:238258579-238258601 CATGGAAAAGGACAGCCTGGGGG - Exonic
1170040766 20:12036863-12036885 CAGTTTGTAGGACAGCCTCATGG - Intergenic
1170355503 20:15488068-15488090 CCTAGACTAGGACAGACTGAAGG - Intronic
1172631769 20:36383339-36383361 GATGGAGTGGGACAGGCTGAAGG + Intronic
1179678523 21:43001368-43001390 CAATGAGCAGGAGAGCCTGCAGG - Intronic
1179922391 21:44514145-44514167 CACTGCCCAGGACAGCCTGAAGG - Intronic
1181686567 22:24533249-24533271 TATTTGGAAGGACAGCCTGAGGG + Intergenic
1181921141 22:26321348-26321370 CATGAAGTAGGACAGCCTGGCGG + Intronic
1184813520 22:46853352-46853374 GGTTGAGTAGAACATCCTGAAGG - Intronic
1184913560 22:47551643-47551665 CAGTGAGCAGGGCTGCCTGATGG + Intergenic
950269930 3:11605583-11605605 AATCAAGGAGGACAGCCTGATGG - Intronic
952158729 3:30671912-30671934 CATTGAGCTGGACACCCTGGTGG + Exonic
953565977 3:44032454-44032476 CTGTGACTTGGACAGCCTGATGG - Intergenic
955893329 3:63673487-63673509 CTTTGACTAGGAAATCCTGAAGG + Intronic
956280763 3:67554202-67554224 CATGTAGTAGCACATCCTGAGGG - Intronic
956748293 3:72326949-72326971 CACTCAGCAGGACAGCCTGAGGG - Intergenic
957840611 3:85663909-85663931 CATTGACTAGAACAGTTTGATGG - Intronic
959726491 3:109548674-109548696 CATTGAGCAGGCCAGTATGAAGG + Intergenic
961402394 3:126656415-126656437 CATTGACATGGGCAGCCTGAAGG + Intergenic
964508960 3:157428582-157428604 CATTAAATAGCACAGACTGATGG + Intronic
969662699 4:8539483-8539505 CATTGAGTAGGAGGGACAGATGG - Intergenic
970971183 4:21986050-21986072 CCTTGAGCAGGACAGCATAATGG - Intergenic
980654945 4:135769522-135769544 CAGGGAGTAGGAAGGCCTGAGGG + Intergenic
981027752 4:140093903-140093925 CAGTGAGCAGGACAACCTGACGG - Intronic
982107097 4:152020621-152020643 CATGGAGGAGGTCAGTCTGAAGG + Intergenic
985546920 5:514505-514527 CACTGGGCAGGACTGCCTGAGGG - Intronic
988191852 5:27947690-27947712 CAAGTAGTAGAACAGCCTGAAGG + Intergenic
992399750 5:76401909-76401931 CATTGAGTCGGAAATTCTGAGGG + Intergenic
995194948 5:109356245-109356267 CATTGAGTTTGGCAGCCTGTTGG - Intronic
995850013 5:116535091-116535113 CAGTGACTAGGATGGCCTGAAGG + Intronic
996703561 5:126473995-126474017 CATTAAGGAGAACAGCCTAAAGG + Intronic
1000537251 5:162493983-162494005 AAGTCAGAAGGACAGCCTGACGG - Intergenic
1000832501 5:166120660-166120682 CAGAAAGTAGGACAGCCTGGAGG - Intergenic
1001610644 5:172998687-172998709 GATTCAGTAGGATAGGCTGATGG - Intronic
1003183113 6:3808756-3808778 CATTGAGGAGGCCAGCCTAGTGG + Intergenic
1003642796 6:7889427-7889449 CACTCAGTAGCTCAGCCTGATGG + Intronic
1005112865 6:22303658-22303680 CATTGAATAAGACAGCCAAAGGG - Intergenic
1006992087 6:38223702-38223724 AACTGAGTATGACAGCGTGAGGG - Intronic
1014787970 6:125639584-125639606 CATTGGGTATGTCAGCCTTAAGG + Intergenic
1017080013 6:150659190-150659212 CTTTGAGTAGACCAGCCTGGTGG - Intronic
1017410101 6:154159075-154159097 CATTGAGTAGGAAAGCTCAAAGG + Exonic
1018090565 6:160343881-160343903 GATTCAGTAGGACAGAATGAAGG + Intergenic
1018317601 6:162572184-162572206 CATTCAGCATGACAGACTGAAGG - Intronic
1018850074 6:167581033-167581055 CATTGGCTTGGACATCCTGATGG - Intergenic
1019510942 7:1417024-1417046 CAGTGAGGAGGAAAACCTGAGGG - Intergenic
1030800027 7:113838230-113838252 CATTCAGTAAGAGAGCCTAAGGG + Intergenic
1031155950 7:118112498-118112520 AATTTAGAAGGACTGCCTGAGGG - Intergenic
1031677517 7:124629642-124629664 CATTGACTAGGACAGAGTGAGGG + Intergenic
1033429145 7:141272792-141272814 CATTGTGGAGAACAGCATGAAGG + Intronic
1033606163 7:142929723-142929745 CAATGAGCAGGGCAGCCTGAGGG - Intronic
1036768044 8:11561264-11561286 CATGGTGAAGGACAGCCTGGGGG - Intronic
1037140967 8:15520325-15520347 CATTAAGTAGCACAGCTGGAAGG - Intronic
1038645575 8:29358938-29358960 CACTGAGCAGCCCAGCCTGATGG - Intergenic
1040595316 8:48832597-48832619 CAGTGAGGAGGACAGACCGAGGG - Intergenic
1042574745 8:70205556-70205578 CCTTTAGTAGGCCATCCTGATGG - Intronic
1043255237 8:78127745-78127767 CATTCAGAATGACAGCCTGATGG + Intergenic
1045173539 8:99696593-99696615 CATCAAGGAGGAGAGCCTGAAGG + Intronic
1046015857 8:108604548-108604570 CATTGGGTAGCACATCCAGAGGG - Intergenic
1046762428 8:118035199-118035221 CATTGAGTAGGACAGCCTGAGGG - Intronic
1047820717 8:128517259-128517281 CAATGAGAATGACAGCATGATGG - Intergenic
1048195966 8:132332046-132332068 CATAGAGTAGGACAGAGTGATGG + Intronic
1048803195 8:138213839-138213861 CAATGAACAGGAGAGCCTGATGG + Intronic
1049302364 8:141878415-141878437 CATTCAGTAGGAGAGCCTGGAGG + Intergenic
1056545170 9:87606896-87606918 CAATGTTTAGGACAGCCTGAAGG - Intronic
1060507142 9:124206433-124206455 CCTTGAGTAGGACAGCTCTACGG - Intergenic
1189217149 X:39336040-39336062 CCTTGAGTAGCACTGCCTGTGGG - Intergenic
1199727535 X:150599412-150599434 CATTGCCCAGGTCAGCCTGAAGG + Intronic
1200074512 X:153544486-153544508 TCCTAAGTAGGACAGCCTGAGGG - Intronic