ID: 1046762429

View in Genome Browser
Species Human (GRCh38)
Location 8:118035200-118035222
Sequence ACATTGAGTAGGACAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046762429_1046762436 22 Left 1046762429 8:118035200-118035222 CCTCAGGCTGTCCTACTCAATGT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1046762436 8:118035245-118035267 ACAGGAAGCTTGGAATTTGGAGG No data
1046762429_1046762435 19 Left 1046762429 8:118035200-118035222 CCTCAGGCTGTCCTACTCAATGT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1046762435 8:118035242-118035264 CACACAGGAAGCTTGGAATTTGG No data
1046762429_1046762434 12 Left 1046762429 8:118035200-118035222 CCTCAGGCTGTCCTACTCAATGT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data
1046762429_1046762432 4 Left 1046762429 8:118035200-118035222 CCTCAGGCTGTCCTACTCAATGT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1046762432 8:118035227-118035249 TGCTAGCCTCACTCGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046762429 Original CRISPR ACATTGAGTAGGACAGCCTG AGG (reversed) Intronic
904030391 1:27529782-27529804 ACAGTGAGCAGGACAGTCAGGGG - Intergenic
917696384 1:177528670-177528692 ACATTGAGTGAGATAGCCTAGGG - Intergenic
917739502 1:177948626-177948648 TTATTTAGTAGGACAGCCTTAGG - Intronic
921066942 1:211630219-211630241 CCGTTGAGAAGGATAGCCTGTGG - Intergenic
923215725 1:231846018-231846040 GCAATGAGAAGGACAGCTTGGGG + Intronic
1063729283 10:8677404-8677426 ACAATGAGGAGGCAAGCCTGCGG + Intergenic
1064302243 10:14132863-14132885 CCATTGAGTAGATCACCCTGGGG - Intronic
1071359025 10:84827083-84827105 ACATTCAGAAGCACAGCCTCTGG - Intergenic
1074232958 10:111555843-111555865 ACCTTGAGTTGTATAGCCTGAGG - Intergenic
1075968729 10:126635035-126635057 ACATTGAGACAGGCAGCCTGAGG - Intronic
1077502379 11:2915195-2915217 ACACTGACTAGGACAGTCAGTGG - Intronic
1077630527 11:3808443-3808465 AGATTGAGGAGGAGAGCCAGGGG + Exonic
1079963673 11:26954248-26954270 ACATAGAGGAGGTCACCCTGGGG + Intergenic
1080761420 11:35253380-35253402 ACTTTGAGTAGCAGAGACTGAGG - Exonic
1081426280 11:42929745-42929767 ACATTGCAGAGGACAGCATGTGG - Intergenic
1085708466 11:78808016-78808038 ACATTCAGTAGCATAGCTTGGGG + Intronic
1086137368 11:83455686-83455708 ACATTGAGTATGAATGACTGTGG - Intronic
1089019876 11:115202311-115202333 TCATTGAGTGTGACAGACTGGGG + Intronic
1089317788 11:117604045-117604067 ACTTTGAGTCAGACAGGCTGGGG - Intronic
1089872726 11:121690720-121690742 AGAATGAGTTGGACAGCCTGGGG - Intergenic
1098562828 12:71896254-71896276 GGATTGAGTAGGACAGAGTGAGG + Intronic
1104628076 12:130376159-130376181 GCATTGTGTTGGACAGCCTAAGG - Intergenic
1105601238 13:21889795-21889817 GCTTTGAGTTGGGCAGCCTGGGG - Intergenic
1108317089 13:49247627-49247649 ACACTGACCATGACAGCCTGGGG + Intergenic
1112447939 13:99483218-99483240 GTAGTGAGTAGGAGAGCCTGGGG - Intergenic
1114258531 14:21021933-21021955 AGAATGAGTAGGACATCCTGAGG - Intronic
1117874912 14:60242300-60242322 AAATTGAGAAGCACTGCCTGGGG - Intergenic
1120736999 14:88064472-88064494 AAATAGAGGAGGACAGGCTGGGG + Intergenic
1122864008 14:104595413-104595435 CCATGGAGCAGGACAGCCTTTGG + Intronic
1123183641 14:106492848-106492870 ACATGGTGTAGGTGAGCCTGAGG + Intergenic
1125420956 15:39503560-39503582 AAGTCGAGTAGGCCAGCCTGGGG - Intergenic
1129101651 15:73270415-73270437 ACATGGAGTATGACAGCCCATGG + Exonic
1131176043 15:90210451-90210473 ACATTCAGGAGCAAAGCCTGAGG + Intronic
1131717867 15:95133025-95133047 ACAATGAATAAGACAACCTGTGG - Intergenic
1132809586 16:1791125-1791147 GCATTGAGGAGCAGAGCCTGTGG - Exonic
1133118982 16:3594900-3594922 GCACTGAGTGGGACAGGCTGCGG + Intronic
1133553620 16:6883598-6883620 ACACAGAGTAGAACAGCTTGAGG - Intronic
1133720252 16:8488105-8488127 GCAATGAGGAGGACACCCTGTGG - Intergenic
1136135144 16:28251760-28251782 ACAAGGCATAGGACAGCCTGGGG + Intergenic
1138392823 16:56682769-56682791 ACATGGAGCAGGACAGCCTTGGG - Intronic
1138456224 16:57122271-57122293 ACATTAAGGAAGGCAGCCTGGGG + Intronic
1139135227 16:64195546-64195568 ACATGGAGTATGACTGCCTTTGG - Intergenic
1149852501 17:60047199-60047221 ACATTTGGTGGGACAGTCTGAGG + Intronic
1151238187 17:72736793-72736815 GCATTAAGTAGGACTGCATGAGG + Intronic
1152331444 17:79675506-79675528 ACCTTGAGCAGGCCAGCCTCGGG + Intergenic
1153217153 18:2831254-2831276 ACATTAATTAGGAAAGACTGTGG - Intergenic
1155372247 18:25113835-25113857 AGAGTGAGTATGTCAGCCTGGGG - Intronic
1155837572 18:30605237-30605259 TCATTGATTAGAACAGCCTGCGG - Intergenic
1156087302 18:33421346-33421368 ACATTGATGAAAACAGCCTGAGG - Intronic
1164656697 19:29927037-29927059 GCAGTGTGGAGGACAGCCTGGGG + Intronic
1165456192 19:35912179-35912201 GCTTTGAGGAGGACAGGCTGTGG - Intergenic
1166259607 19:41628203-41628225 GCATGGAGTTGGACATCCTGGGG - Intronic
1166500055 19:43333454-43333476 GCATGGAGTTGGGCAGCCTGGGG - Intergenic
925081791 2:1075220-1075242 ACAGTGCCTAGGACAGGCTGGGG - Intronic
926271846 2:11372550-11372572 TCAATGAAGAGGACAGCCTGGGG - Intergenic
930086706 2:47503027-47503049 ACATTGAGTCAGAAAGCATGTGG + Intronic
931266678 2:60666647-60666669 ACATTTAGTAGGACAAAATGGGG + Intergenic
931452613 2:62380955-62380977 AACTTGATTAGGACAGGCTGAGG - Intergenic
932213132 2:69948378-69948400 ACGTTGAGTGGAACAGGCTGAGG - Intergenic
935597280 2:104889103-104889125 ACATTCAGTAGCACAGCCTCTGG - Intergenic
936480782 2:112883248-112883270 ATATGGAATAGGACAGCCTCTGG + Intergenic
936983193 2:118283385-118283407 ACAATGGGCAGGACACCCTGGGG + Intergenic
937211576 2:120276073-120276095 ACATAGAGTAGCTCAGGCTGAGG - Intronic
937457290 2:122053631-122053653 ACATGGCATAGGACAGCCTTGGG + Intergenic
939431677 2:142117531-142117553 ACATTGAGGCTAACAGCCTGTGG - Intronic
943575233 2:189624381-189624403 ACAGTGAAGAGGGCAGCCTGAGG - Intergenic
947795602 2:232892109-232892131 ACATTGAGAAGGCAAGCATGTGG - Intronic
948482425 2:238258580-238258602 CCATGGAAAAGGACAGCCTGGGG - Exonic
1175384083 20:58583167-58583189 ACAATGAGGAGGAAAGGCTGGGG + Intergenic
1175594156 20:60217214-60217236 AGAGTGAGAAGGACAACCTGGGG + Intergenic
1177489228 21:21800583-21800605 AGATTGACTAGAGCAGCCTGTGG - Intergenic
1178967704 21:37138693-37138715 CCTTGGAATAGGACAGCCTGAGG + Exonic
1179880848 21:44292815-44292837 ACACTGAGTGGGAAAGGCTGTGG - Intronic
956280764 3:67554203-67554225 ACATGTAGTAGCACATCCTGAGG - Intronic
956748294 3:72326950-72326972 GCACTCAGCAGGACAGCCTGAGG - Intergenic
959629725 3:108494086-108494108 ACAGGGAGGAAGACAGCCTGGGG + Intronic
961819936 3:129570915-129570937 AGAAGGAGCAGGACAGCCTGGGG - Exonic
963182969 3:142379793-142379815 ACATTGATTAGCACACCCTCTGG - Intronic
964049724 3:152375628-152375650 ATATTGAGAAGAATAGCCTGGGG - Intronic
966354714 3:179067749-179067771 TCATTGGGTAGGGAAGCCTGGGG + Exonic
967617890 3:191595032-191595054 ACAGTGAGAAGGACAGTCTTTGG + Intergenic
968126432 3:196163835-196163857 CCATTGTGTAGGCCTGCCTGGGG - Intergenic
970193493 4:13535687-13535709 ACATAGAGTAAGGCCGCCTGAGG - Intergenic
972513604 4:39792779-39792801 ACTTTGAGAAGACCAGCCTGGGG + Intergenic
976095781 4:81506898-81506920 TCATTGACTGGGGCAGCCTGGGG - Intronic
976567294 4:86565880-86565902 ACAATGAATAGGCCAGTCTGTGG - Intronic
978100550 4:104835134-104835156 ACACTGAGAAAGACAGCATGGGG + Intergenic
981780692 4:148426205-148426227 ACATTGAAGAGGAGAACCTGGGG - Intronic
986379503 5:7169446-7169468 ACACTGAGAAGGACAGCATTGGG + Intergenic
991972296 5:72152824-72152846 ACATTGTGCAGCTCAGCCTGTGG + Intronic
992621042 5:78593387-78593409 CGATTGAGGAAGACAGCCTGGGG + Intronic
996548426 5:124705674-124705696 ACCTTGAGAAGCTCAGCCTGGGG + Intronic
997042775 5:130277721-130277743 ACACTCACTGGGACAGCCTGCGG - Intergenic
997696293 5:135863744-135863766 TCATAGAGTTGCACAGCCTGGGG - Intronic
999305666 5:150517971-150517993 CCATTGATAAGGGCAGCCTGTGG - Intronic
999759992 5:154692361-154692383 ACATTCCGCAGGACAGGCTGAGG + Intergenic
1002064474 5:176645212-176645234 ACATTGAGCTGGACCGGCTGTGG + Exonic
1002612651 5:180431595-180431617 ACACTGGGCAGGACAGCGTGGGG + Intergenic
1005112866 6:22303659-22303681 ACATTGAATAAGACAGCCAAAGG - Intergenic
1005286734 6:24335821-24335843 ACTATGAGTAGAACAGCATGGGG + Intronic
1005856504 6:29866897-29866919 GGATTGAGAAGAACAGCCTGGGG - Intergenic
1006992088 6:38223703-38223725 AAACTGAGTATGACAGCGTGAGG - Intronic
1010932537 6:81819753-81819775 ACAGTGCGTAGGGCATCCTGTGG - Intergenic
1011430714 6:87283658-87283680 AGATTGAGTAGGACAGGGAGTGG + Exonic
1014885465 6:126775425-126775447 ACATCTATTAAGACAGCCTGGGG - Intergenic
1017047804 6:150363786-150363808 ACAATGATGAGAACAGCCTGGGG + Intergenic
1017328468 6:153168309-153168331 ACATTGAGGATGACATTCTGGGG + Intergenic
1024059473 7:45687097-45687119 AAATTGAGTAGGTCAGCAGGTGG + Intronic
1024125984 7:46295058-46295080 CCATTGGGGAGGACAGCATGTGG - Intergenic
1024409774 7:49026799-49026821 CCATTGAGGAGTGCAGCCTGGGG + Intergenic
1025118848 7:56281941-56281963 ACACTGAGTAGTCCATCCTGAGG + Intergenic
1030761032 7:113352046-113352068 ACAATCAATAGGACAGTCTGAGG + Intergenic
1030800026 7:113838229-113838251 ACATTCAGTAAGAGAGCCTAAGG + Intergenic
1031155951 7:118112499-118112521 AAATTTAGAAGGACTGCCTGAGG - Intergenic
1031677516 7:124629641-124629663 TCATTGACTAGGACAGAGTGAGG + Intergenic
1033545002 7:142391760-142391782 ACATGGAGTAGCAGAACCTGAGG + Intergenic
1033548153 7:142421111-142421133 ACATGGAATAGCAGAGCCTGAGG + Intergenic
1033606164 7:142929724-142929746 TCAATGAGCAGGGCAGCCTGAGG - Intronic
1034009067 7:147508003-147508025 ATGTTGAGAAGGAAAGCCTGAGG - Intronic
1034958794 7:155351568-155351590 AAATGGAGGAGGAAAGCCTGGGG + Intergenic
1036768045 8:11561265-11561287 ACATGGTGAAGGACAGCCTGGGG - Intronic
1040110341 8:43564393-43564415 AGGTTGAGTTGAACAGCCTGCGG + Intergenic
1044095935 8:88064601-88064623 CCATTTATTGGGACAGCCTGAGG - Intronic
1044504871 8:93006139-93006161 ACATTGACGAGGACCACCTGTGG + Intronic
1045910933 8:107409197-107409219 ACAGTTAGAAGGAAAGCCTGGGG - Intronic
1046762429 8:118035200-118035222 ACATTGAGTAGGACAGCCTGAGG - Intronic
1049297845 8:141852610-141852632 ACAATGAACAAGACAGCCTGCGG + Intergenic
1049316131 8:141969346-141969368 ACACTGAGAAGGAGGGCCTGGGG - Intergenic
1049725670 8:144144630-144144652 ACATTCAGGAGCCCAGCCTGTGG + Intergenic
1050146573 9:2574431-2574453 ACGATGAGTAATACAGCCTGGGG + Intergenic
1051491371 9:17670108-17670130 ACATGGAGTAGCTCAGGCTGAGG - Intronic
1055034809 9:71807051-71807073 TTATTAAGTAGGACAGCCTCTGG + Intronic
1056788139 9:89606932-89606954 TCATTGTGCAGGAAAGCCTGAGG - Intergenic
1187137190 X:16559371-16559393 ACATTGTGTTGGACTGCCTGTGG - Intergenic
1188216629 X:27486786-27486808 AAATTGAGAGTGACAGCCTGGGG - Intergenic
1189033653 X:37474611-37474633 ACATGGAGTAGCTCAGGCTGAGG + Intronic
1189217151 X:39336041-39336063 GCCTTGAGTAGCACTGCCTGTGG - Intergenic
1190739763 X:53281266-53281288 ACCCTGAGCAGCACAGCCTGTGG - Intronic
1190944578 X:55079179-55079201 ACATGGAGTAGCTCAGGCTGAGG + Intergenic
1190945821 X:55093112-55093134 ACATGGAGTAGCTCAGGCTGAGG + Intronic
1190964806 X:55289067-55289089 ACATGGAGTAGCTCAGGCTGAGG + Intergenic
1191642789 X:63446373-63446395 TAATTGGGTAGGACAGCTTGTGG + Intergenic
1192539466 X:71955922-71955944 CCAAAGAGCAGGACAGCCTGAGG + Intergenic
1193239901 X:79155957-79155979 ACATAGAGGGGGACAGCCTTAGG - Intergenic
1195388908 X:104340708-104340730 ACATGGATTAGGATAGGCTGTGG + Intergenic
1196395310 X:115254996-115255018 AAAAAGAGCAGGACAGCCTGGGG - Intergenic
1197723368 X:129759815-129759837 ACTTTGGGCAGGACAGCCAGAGG - Intronic
1200698831 Y:6385088-6385110 ACAATGTCTAGGCCAGCCTGAGG + Intergenic
1201035281 Y:9779611-9779633 ACAATGTCTAGGCCAGCCTGAGG - Intergenic
1201420076 Y:13788547-13788569 GCATTGAGCAGCACAGCATGTGG - Intergenic