ID: 1046762431

View in Genome Browser
Species Human (GRCh38)
Location 8:118035211-118035233
Sequence GCTAGCAAACCACATTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046762431_1046762436 11 Left 1046762431 8:118035211-118035233 CCTACTCAATGTGGTTTGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1046762436 8:118035245-118035267 ACAGGAAGCTTGGAATTTGGAGG No data
1046762431_1046762435 8 Left 1046762431 8:118035211-118035233 CCTACTCAATGTGGTTTGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1046762435 8:118035242-118035264 CACACAGGAAGCTTGGAATTTGG No data
1046762431_1046762434 1 Left 1046762431 8:118035211-118035233 CCTACTCAATGTGGTTTGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data
1046762431_1046762432 -7 Left 1046762431 8:118035211-118035233 CCTACTCAATGTGGTTTGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1046762432 8:118035227-118035249 TGCTAGCCTCACTCGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046762431 Original CRISPR GCTAGCAAACCACATTGAGT AGG (reversed) Intronic
910011007 1:82462042-82462064 GCTTGCAAATCACATTGACTGGG + Intergenic
911955645 1:104231208-104231230 GCTATCAAACAACATTGTGCTGG - Intergenic
918142415 1:181730755-181730777 GCTAGCATAGCACATTCATTGGG - Intronic
921137571 1:212275296-212275318 TCTAGCAAACCAGGATGAGTTGG + Intergenic
1065820742 10:29523026-29523048 GCTAGCAAGCTACACTGCGTGGG - Intronic
1068885243 10:62091275-62091297 GCTGGCAAACCAGAATGAGACGG + Exonic
1072642721 10:97224649-97224671 GTCAGCAAACCACATTTTGTGGG + Exonic
1073204962 10:101763960-101763982 GCAAGCAATCCACATAGAGCAGG - Intergenic
1077454314 11:2669185-2669207 GTTAGCAAACTACAGTGAGAAGG - Intronic
1089488654 11:118867421-118867443 GCTAGCAACCCACATCCACTTGG + Intergenic
1091633075 12:2176901-2176923 GCTAGCAAGGCACATTCAGGGGG + Intronic
1093484968 12:19642471-19642493 TCTTGCAAACCACAGTGAGTGGG + Intronic
1100660589 12:96694301-96694323 GCTTGAACACCACATGGAGTGGG + Intronic
1103139403 12:118535570-118535592 CCTAGCAAACCAGAATGATTTGG - Intergenic
1103633495 12:122282938-122282960 GTTAGCAACCCACAGTGAGCCGG + Intronic
1104514716 12:129414266-129414288 GCTAGGAAACCATAATGAGCCGG - Intronic
1108062876 13:46551178-46551200 GTAAACAAACCACAATGAGTAGG + Intergenic
1110634900 13:77755422-77755444 GCTACTAATACACATTGAGTTGG - Intronic
1112008000 13:95270721-95270743 GTCTGCAAACCACACTGAGTAGG + Intronic
1121087661 14:91158778-91158800 GCTAGATAACCACATTGTGTTGG - Intronic
1121880130 14:97492570-97492592 GCCTGCATACCACATTTAGTGGG + Intergenic
1123474209 15:20577448-20577470 GCCAGCAAAGAACATAGAGTTGG - Intergenic
1123643802 15:22422905-22422927 GCCAGCAAAGAACATAGAGTTGG + Intergenic
1123665082 15:22602516-22602538 GCCAGCAAAGAACATAGAGTTGG + Intergenic
1123734510 15:23172460-23172482 GCCAGCAAAGAACATAGAGTTGG - Intergenic
1123752678 15:23370137-23370159 GCCAGCAAAGAACATAGAGTTGG - Intergenic
1124285017 15:28393768-28393790 GCCAGCAAAGAACATAGAGTTGG - Intergenic
1124297680 15:28517846-28517868 GCCAGCAAAGAACATAGAGTTGG + Intergenic
1124318914 15:28696938-28696960 GCCAGCAAAGAACATAGAGTTGG + Intergenic
1130029818 15:80302293-80302315 ACTAGCAAACAAAATTCAGTGGG - Intergenic
1142366922 16:89655324-89655346 GCCAGCATCCCACAGTGAGTTGG - Intronic
1147307760 17:39575432-39575454 TCTTGCAACCCACATTGACTGGG + Intergenic
1148389159 17:47257899-47257921 GCAAGCACACCACAGTGAGGAGG + Intronic
1149362295 17:55908552-55908574 GCTAGCCCATCATATTGAGTAGG - Intergenic
926531001 2:14044925-14044947 GCTAGAAAATCAAATTGAGATGG - Intergenic
927519977 2:23692783-23692805 CCTAGCGAGCCAGATTGAGTGGG + Intronic
933164902 2:79065224-79065246 GGTGGCATACCACATTTAGTAGG - Intergenic
941081297 2:161063765-161063787 GCTAGCAATAAACATCGAGTTGG - Intergenic
943275582 2:185863439-185863461 ACTAGCAAACCAAATTCAGTAGG - Intergenic
1170083929 20:12508366-12508388 GGAAGCTAAACACATTGAGTGGG - Intergenic
1173121174 20:40290763-40290785 GTTAACAAAACACATGGAGTAGG - Intergenic
952931167 3:38361987-38362009 TCTAGCAAAACCCAGTGAGTGGG - Intronic
953301634 3:41782989-41783011 GCCAGCAAAGAACATAGAGTTGG + Intronic
953558941 3:43969875-43969897 GCAAGCAAACCCCATTGCATCGG + Intergenic
955788004 3:62560091-62560113 GTTGGTAAACCAAATTGAGTTGG + Intronic
957613057 3:82493806-82493828 CCTAGTAAACCACATTAAATTGG + Intergenic
957946401 3:87068796-87068818 AATAGCAAACTACTTTGAGTAGG + Intergenic
959584346 3:108012237-108012259 GGCAGTAAACCATATTGAGTTGG - Intergenic
965240812 3:166194816-166194838 GCTAGAAAATCATATAGAGTTGG - Intergenic
972314264 4:37911352-37911374 GCTGACAGACCACAATGAGTAGG - Intronic
981849807 4:149217062-149217084 GCTAGCTAATCAAATTCAGTAGG - Intergenic
983952318 4:173656578-173656600 GCTACCAAAAAATATTGAGTGGG - Intergenic
984861617 4:184245413-184245435 GCTAGTAGTACACATTGAGTTGG - Intergenic
985428643 4:189856294-189856316 TCTAGCTAACCTCATTTAGTAGG - Intergenic
985993429 5:3582696-3582718 GCTCAGAAACCACATGGAGTGGG - Intergenic
991029111 5:62064232-62064254 GCTAGCAAAAAACATGTAGTTGG + Intergenic
997202233 5:132017953-132017975 GTTAGAAAACCACAGTGAGCTGG + Intergenic
999651786 5:153775127-153775149 GCTAGCAAGATACATTAAGTTGG - Intronic
1000451613 5:161395880-161395902 TCTTGCAAATCACATTGAGTTGG - Intronic
1003155589 6:3590841-3590863 ACTAGGAAACCACATGGGGTAGG + Intergenic
1018063416 6:160108298-160108320 GCAAGATAGCCACATTGAGTTGG + Intronic
1029712716 7:102308411-102308433 GCTGGCCAAGCACACTGAGTAGG - Intronic
1031910285 7:127509712-127509734 CATAGCAAAACAAATTGAGTAGG + Intergenic
1035821836 8:2601152-2601174 GGTAGCAACACACATTGAGGCGG - Intergenic
1046762431 8:118035211-118035233 GCTAGCAAACCACATTGAGTAGG - Intronic
1055667063 9:78563486-78563508 GCTGGCAAACAACATTGTGCAGG - Intergenic
1055780711 9:79818556-79818578 GTTAGCAAACCACATCTAGCTGG + Intergenic
1055879451 9:80982013-80982035 CCCAGCAAACCTCATTGAATGGG - Intergenic
1056289308 9:85126874-85126896 GCTATCAAATCACATTGCCTGGG - Intergenic
1058352445 9:104041827-104041849 GCTGGCAAACCTCATTCATTGGG - Intergenic
1058857110 9:109073360-109073382 TCTAGCAAATCACCCTGAGTGGG - Exonic
1060441847 9:123647263-123647285 GCCAGCAAACCACAGTGAAAAGG + Intronic
1188266123 X:28077238-28077260 GCCAGCAAGCCACTTTGAATAGG - Intergenic
1194118231 X:89929288-89929310 GCTAACACACTACATTGACTTGG - Intergenic
1194404067 X:93472306-93472328 ACTAGCAAACCAAATTCAGCAGG + Intergenic
1200471109 Y:3586853-3586875 GCTAACACACTACATTGACTTGG - Intergenic