ID: 1046762434

View in Genome Browser
Species Human (GRCh38)
Location 8:118035235-118035257
Sequence TCACTCGCACACAGGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046762431_1046762434 1 Left 1046762431 8:118035211-118035233 CCTACTCAATGTGGTTTGCTAGC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data
1046762428_1046762434 13 Left 1046762428 8:118035199-118035221 CCCTCAGGCTGTCCTACTCAATG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data
1046762429_1046762434 12 Left 1046762429 8:118035200-118035222 CCTCAGGCTGTCCTACTCAATGT 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data
1046762426_1046762434 29 Left 1046762426 8:118035183-118035205 CCATGGTGTAACTTAACCCTCAG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1046762434 8:118035235-118035257 TCACTCGCACACAGGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046762434 Original CRISPR TCACTCGCACACAGGAAGCT TGG Intronic
No off target data available for this crispr