ID: 1046765065

View in Genome Browser
Species Human (GRCh38)
Location 8:118060251-118060273
Sequence TTAAGCCAGTGGTCACAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046765060_1046765065 18 Left 1046765060 8:118060210-118060232 CCCTTTAGTCAAGGACCAATAGA 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG No data
1046765059_1046765065 26 Left 1046765059 8:118060202-118060224 CCTAGATTCCCTTTAGTCAAGGA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG No data
1046765062_1046765065 3 Left 1046765062 8:118060225-118060247 CCAATAGATCCATTTATCAACAC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG No data
1046765063_1046765065 -6 Left 1046765063 8:118060234-118060256 CCATTTATCAACACATCTTAAGC 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG No data
1046765061_1046765065 17 Left 1046765061 8:118060211-118060233 CCTTTAGTCAAGGACCAATAGAT 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046765065 Original CRISPR TTAAGCCAGTGGTCACAAAT TGG Intronic
No off target data available for this crispr