ID: 1046770495

View in Genome Browser
Species Human (GRCh38)
Location 8:118112158-118112180
Sequence CCCGGCCGCCGCGTTTCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046770495_1046770500 -9 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770500 8:118112172-118112194 GCGGCCGGGGAAGGAGGCACCGG No data
1046770495_1046770507 18 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770507 8:118112199-118112221 GGCCCCGTGCCGCGCGGCCCCGG No data
1046770495_1046770513 27 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG No data
1046770495_1046770504 -3 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770504 8:118112178-118112200 GGGGAAGGAGGCACCGGCAGGGG No data
1046770495_1046770503 -4 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770503 8:118112177-118112199 CGGGGAAGGAGGCACCGGCAGGG No data
1046770495_1046770502 -5 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770502 8:118112176-118112198 CCGGGGAAGGAGGCACCGGCAGG No data
1046770495_1046770506 12 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770506 8:118112193-118112215 GGCAGGGGCCCCGTGCCGCGCGG No data
1046770495_1046770508 19 Left 1046770495 8:118112158-118112180 CCTGCGGAAACGCGGCGGCCGGG No data
Right 1046770508 8:118112200-118112222 GCCCCGTGCCGCGCGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046770495 Original CRISPR CCCGGCCGCCGCGTTTCCGC AGG (reversed) Intergenic