ID: 1046777482

View in Genome Browser
Species Human (GRCh38)
Location 8:118179475-118179497
Sequence GTCTTCAGGGATGCTTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046777478_1046777482 15 Left 1046777478 8:118179437-118179459 CCGAAAAAAAAAAAAAAAAAAGA 0: 843
1: 15463
2: 19308
3: 33435
4: 76723
Right 1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG No data
1046777477_1046777482 21 Left 1046777477 8:118179431-118179453 CCGTCTCCGAAAAAAAAAAAAAA 0: 39
1: 5374
2: 92730
3: 86570
4: 118040
Right 1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046777482 Original CRISPR GTCTTCAGGGATGCTTAATG TGG Intergenic
No off target data available for this crispr