ID: 1046779622

View in Genome Browser
Species Human (GRCh38)
Location 8:118201233-118201255
Sequence ATGCAGAGCCAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 547}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046779622_1046779631 25 Left 1046779622 8:118201233-118201255 CCAGCCTCCTTCTGGCTCTGCAT 0: 1
1: 0
2: 3
3: 70
4: 547
Right 1046779631 8:118201281-118201303 CTGATCCTTTCTTTTTCCCAGGG No data
1046779622_1046779628 -3 Left 1046779622 8:118201233-118201255 CCAGCCTCCTTCTGGCTCTGCAT 0: 1
1: 0
2: 3
3: 70
4: 547
Right 1046779628 8:118201253-118201275 CATATGTGTGGGGTTGTTCCAGG No data
1046779622_1046779630 24 Left 1046779622 8:118201233-118201255 CCAGCCTCCTTCTGGCTCTGCAT 0: 1
1: 0
2: 3
3: 70
4: 547
Right 1046779630 8:118201280-118201302 GCTGATCCTTTCTTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046779622 Original CRISPR ATGCAGAGCCAGAAGGAGGC TGG (reversed) Intronic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900125199 1:1065837-1065859 AAGCAGAGAGAGAAGGCGGCAGG + Intergenic
900645261 1:3706124-3706146 GGGCAGAGCCAGGCGGAGGCGGG - Intronic
900765256 1:4500739-4500761 ACGCATAGCCAGACGGAGGAGGG + Intergenic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
901194465 1:7432748-7432770 ATGCAGGGCCACAAGGGGGACGG - Intronic
901491027 1:9596297-9596319 ATGCAGAGCCAGAAAGACCTGGG - Intronic
901756430 1:11444224-11444246 CTGCAGAGCCAGGAGGATGCTGG - Intergenic
901799241 1:11697891-11697913 ATACAGAGCCACAGGGAGGCAGG + Intronic
902361462 1:15944601-15944623 CTGCAGGGCCAGAAGGCGACAGG + Intronic
902721940 1:18309688-18309710 GGGCAGAGGCAAAAGGAGGCCGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903228740 1:21909134-21909156 GGACAGAGCCAGAAGGAGTCAGG + Intronic
903442010 1:23395280-23395302 AGACAGAGTCAGAAAGAGGCTGG - Intronic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905251383 1:36650932-36650954 AGGCAGAGGCAGAAGGAGGTTGG + Intergenic
905276063 1:36819015-36819037 ATGCAGAGACAGCAGGGAGCAGG - Intronic
905476043 1:38228965-38228987 TTGCAGAGCCAGCAGGTGCCTGG + Intergenic
905520502 1:38595811-38595833 ATGCAGAGGAAGGAGGCGGCTGG + Intergenic
906746425 1:48225127-48225149 CTGCTGAGCCAGAGGGAAGCAGG + Intronic
907841164 1:58158785-58158807 CTGCAGAGCCAGAAAGATGCAGG + Intronic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
908910001 1:69062271-69062293 ACACAGAGACAGAGGGAGGCGGG + Intergenic
909152756 1:72029182-72029204 ATTCAGAGGTAGAAGAAGGCTGG + Intronic
909433990 1:75619127-75619149 AGGGAGAGCGGGAAGGAGGCAGG + Intergenic
910118696 1:83760826-83760848 ATGCAGACACATAAGGATGCTGG + Intergenic
912308241 1:108593234-108593256 GTGCAGAGCCAGAAGGAAGGTGG - Intronic
912385886 1:109270965-109270987 ATGGAGAGCCAGCAGAAGTCAGG - Exonic
912609429 1:111028273-111028295 GTACAGAGACAGAAGGAGGGGGG - Intergenic
913961326 1:143339920-143339942 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914055679 1:144165493-144165515 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914123467 1:144800869-144800891 GTGCAGAGGCAGCAGGTGGCAGG - Intergenic
914878384 1:151529395-151529417 CGGCAGAGCCAGGAGGTGGCTGG + Exonic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915116458 1:153603739-153603761 ATACAGAGACAGAGGGAGGGGGG - Intergenic
915496178 1:156284323-156284345 TTGCAGAGCCAGCAGGTAGCTGG + Exonic
915529156 1:156493540-156493562 ATGCCCAGCCAGATGGAGGGGGG + Intronic
915562735 1:156696877-156696899 AGGAAAAGCCAGCAGGAGGCTGG - Intergenic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916564150 1:165958629-165958651 ATGCAGGGCAAGATGCAGGCAGG + Intergenic
916771434 1:167912633-167912655 ATACAGAGACAGAGGGAGGGGGG - Intronic
916839349 1:168583997-168584019 ACCCAGAGGAAGAAGGAGGCTGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920262142 1:204695828-204695850 ACACAGAGCCTGAGGGAGGCTGG + Intergenic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921275921 1:213520104-213520126 ATTAAGAGCAAGAAGGAGACAGG - Intergenic
921279259 1:213549542-213549564 AAGTAGGGCAAGAAGGAGGCAGG + Intergenic
921311923 1:213853135-213853157 AGGCAGAGGCAGAGGGTGGCAGG - Intergenic
922550607 1:226491473-226491495 ATACAGAGACAGAGGGAGGGGGG + Intergenic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
922741122 1:228014755-228014777 ATGCAGGGGAAGAAGGAGGCTGG - Intronic
923073040 1:230583286-230583308 GTGCAGAGCCAGATGGATCCTGG - Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
924527257 1:244863676-244863698 AGGCAGGGCCAGCAGCAGGCGGG - Exonic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1062782318 10:225447-225469 AAGCTGAGGCAGGAGGAGGCTGG - Intronic
1063000079 10:1909073-1909095 ATTCTGAGCACGAAGGAGGCAGG + Intergenic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1064179533 10:13102197-13102219 ACGCAGAGACAGAAGAATGCAGG + Intronic
1064557959 10:16566507-16566529 AGGCAGAGCGAGAGGGAGGGAGG + Intergenic
1065121992 10:22539180-22539202 ACACAGAGCCAGGAGGGGGCTGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1065781402 10:29171685-29171707 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1065940505 10:30560104-30560126 ATGCAGAGTCAGAAGCAGCGGGG - Intergenic
1066110025 10:32187649-32187671 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1067029777 10:42872318-42872340 GTGCAGAGGCAGCAGGCGGCAGG + Intergenic
1067089528 10:43259547-43259569 ATGCAGGGAGAGGAGGAGGCTGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067561745 10:47309445-47309467 ATGCAGAGGCAGTAGAGGGCAGG + Intronic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1067730072 10:48804190-48804212 AGCCTGAGCCAGGAGGAGGCAGG - Intronic
1068149692 10:53116226-53116248 TTACATAGCCACAAGGAGGCTGG - Intergenic
1070428395 10:76311911-76311933 AAGCAGAGCCAACAGGTGGCAGG - Intronic
1070504839 10:77103993-77104015 ATGGAGAGGCAGCAGGACGCAGG + Intronic
1070645416 10:78198781-78198803 ATGCTGAGACACAAGGAGGAAGG + Intergenic
1070803243 10:79255626-79255648 ATGCAGAGACAGAGATAGGCAGG - Intronic
1071154329 10:82672151-82672173 AAGCTGAGCCAGAAAGAAGCAGG + Intronic
1071786908 10:88911330-88911352 ATGAACAGCCAGTAGGAGGTAGG + Intronic
1072220855 10:93326454-93326476 CTGCAGAGCTAGAAGACGGCAGG + Intronic
1072247259 10:93554743-93554765 AAGCAGAGCCACAAGGAGAAGGG - Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072619644 10:97071277-97071299 ATTAAGAGCCAGATGGAGGCAGG + Intronic
1073135110 10:101216011-101216033 AATCAGAGACTGAAGGAGGCGGG + Intergenic
1075084545 10:119405687-119405709 ATGCAGAGCTGGAAAGTGGCAGG - Intronic
1075465393 10:122646980-122647002 ATGCAGAAGCAGCAGGAAGCTGG + Intergenic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076238605 10:128884686-128884708 AGGCAGGGCCGGAAGGAGGGAGG - Intergenic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076600554 10:131654522-131654544 AAGCAGGGCCAGGAAGAGGCAGG - Intergenic
1076751699 10:132546618-132546640 ATCCAGAGTGGGAAGGAGGCGGG - Intronic
1076879536 10:133233138-133233160 AGGCTGAGGCAGGAGGAGGCAGG + Intergenic
1077087265 11:760049-760071 ACGCAGAGCAAGCTGGAGGCCGG - Intronic
1077158550 11:1102314-1102336 AGGAAGAGCCAGCAGGAAGCTGG - Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077245587 11:1535689-1535711 GTGCAGGGCCAGCAGGAGGGCGG + Intergenic
1077423099 11:2462144-2462166 ATGGAGAGCCCCAAGGAGCCAGG + Intronic
1077610995 11:3642922-3642944 AGCCAGAGCCAGGAGGAGGTGGG + Intergenic
1079119949 11:17674910-17674932 ATGCAGAGAAAGAAGAAGCCTGG + Intergenic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1079240845 11:18721276-18721298 GGGCAGAGCCAGAACGTGGCGGG - Intronic
1079805088 11:24921196-24921218 ATACAGAGACAGAGGGAGGGGGG + Intronic
1080239404 11:30109466-30109488 GTGCAGGGCCAGAAGCAGGCAGG - Intergenic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1083151156 11:60792673-60792695 ATGCAAATCCAGCTGGAGGCTGG - Intronic
1083691184 11:64409802-64409824 AACCAGAGAGAGAAGGAGGCGGG - Intergenic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083868289 11:65470670-65470692 ATACAGGGCCAGAAGGATCCAGG + Intergenic
1084370079 11:68735439-68735461 CTACAGAGTCAGGAGGAGGCCGG + Intronic
1084410484 11:69003635-69003657 GAGCAGAGCCAGGAGCAGGCAGG - Intergenic
1084696835 11:70760882-70760904 GAGAAGAGCCAGCAGGAGGCGGG + Intronic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1085409255 11:76281803-76281825 CTCCAGAGTCACAAGGAGGCAGG - Intergenic
1085468088 11:76737789-76737811 ATCAAGACCCAGTAGGAGGCAGG - Intergenic
1085532570 11:77200738-77200760 TTGAAGAGCCAGAAGAAGGGAGG - Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089218650 11:116852275-116852297 AGGCAGAGCCCAAAGGAGGGTGG - Intronic
1089358883 11:117873568-117873590 AGGCACAGCCCCAAGGAGGCAGG - Intronic
1089410853 11:118241444-118241466 CTGCAGAGCCAGCAGGTGACAGG - Intronic
1089626046 11:119751692-119751714 ATGCAGAGAAGGAAGCAGGCAGG - Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1090106804 11:123862178-123862200 TCCCAGAGCCAGCAGGAGGCAGG + Intergenic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090509486 11:127359520-127359542 AACCAGAGCCAGAAGAAAGCAGG - Intergenic
1091078496 11:132643437-132643459 ATGCAGAGCCTCAGGGAGGCTGG + Intronic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091534043 12:1388518-1388540 CTCCAGAGCCAGGAGGAGACAGG + Intronic
1091895812 12:4103327-4103349 ATCCAGAGCCAGAAGGACAGTGG + Intergenic
1092033934 12:5314047-5314069 ATGGAAAGCTAGAAGGAGCCTGG + Intergenic
1092164302 12:6333546-6333568 ATGCAGGGACAGGAGGATGCAGG - Intronic
1094328997 12:29272248-29272270 TTGCAGTACCAGAAGGAGACGGG - Intronic
1094473286 12:30822892-30822914 CTGCAGTGCCAGGAGCAGGCAGG + Intergenic
1094596769 12:31873251-31873273 ATGGAGAGCCAGACGGTGGGTGG + Intergenic
1096076668 12:48810311-48810333 ACACAGAGCCAGAAGGAGTCTGG - Intergenic
1096115958 12:49055302-49055324 ATGGACAGCCAGAAGCTGGCTGG - Exonic
1096446299 12:51695588-51695610 ATGCAGAGCCAGAAAGCCACAGG + Intronic
1096464382 12:51840243-51840265 ATGCAGACCCAAGAGGAGACAGG - Intergenic
1096500083 12:52059321-52059343 AGAGAGAGCCAGCAGGAGGCTGG - Exonic
1096528840 12:52231030-52231052 ATGGAGAGGCAGGAGGAGACTGG + Intergenic
1096612885 12:52814516-52814538 TTGCAGAGCTAGGAGGTGGCAGG - Exonic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097194144 12:57234653-57234675 CTTCAGAGCCAGTAGCAGGCAGG + Exonic
1097845882 12:64364867-64364889 ATGCAGTGCCCAAAGGAGGCGGG - Intronic
1099910957 12:88832808-88832830 ATGCAGGGCCCGCTGGAGGCTGG + Intergenic
1100161447 12:91865393-91865415 TTACAGAGCCAGTGGGAGGCTGG - Intergenic
1100406694 12:94278057-94278079 ATACAGAGACAGAGGGAGGGGGG - Exonic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101557248 12:105821876-105821898 TTGCAGAGCAGGAAGGTGGCTGG + Intergenic
1101945687 12:109134667-109134689 ATTCAGAGGCAAAAGGAGACGGG + Intronic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1103186649 12:118963727-118963749 AGCCAGCCCCAGAAGGAGGCTGG - Intergenic
1103870515 12:124087866-124087888 ATGCACGGGCTGAAGGAGGCTGG - Intronic
1105069017 12:133222695-133222717 ATGCAGGGCCAGAAAGAAGAAGG - Intronic
1105778067 13:23681003-23681025 ATGCAGAACCAGCTGCAGGCAGG - Intergenic
1106460034 13:29960545-29960567 ATGCAGAGCAGCAAAGAGGCAGG - Intergenic
1108071251 13:46630923-46630945 AGGCAGAACCAGAAGCAAGCTGG - Intronic
1108072445 13:46642044-46642066 CTGCAGAGCCAGACCTAGGCTGG + Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109945005 13:69421143-69421165 CTGCAGGGCCAGCAGGAGACAGG - Intergenic
1110406915 13:75160910-75160932 CTCCAGATCCAGAAGGAGGGTGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111340753 13:86882516-86882538 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112237668 13:97650917-97650939 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1112916996 13:104564068-104564090 ATGCACATCCAGATTGAGGCCGG + Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1115099597 14:29682815-29682837 ATGCAAAGCTGGGAGGAGGCAGG + Intronic
1115131159 14:30053458-30053480 ATGCAGAGCAAGGGGAAGGCAGG + Intronic
1115645822 14:35367955-35367977 ATGCAGGGCTGGGAGGAGGCGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116399351 14:44486363-44486385 CTGCAGAGAAAGAAGCAGGCTGG - Intergenic
1117652459 14:57921265-57921287 ATGCAGAGGGATAAGAAGGCAGG + Intronic
1117922403 14:60738829-60738851 ATTAAGAGCCAAAATGAGGCTGG - Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118601096 14:67471962-67471984 AGTCAGAGCCGGAAGTAGGCTGG + Exonic
1118654090 14:67928367-67928389 ATACAGAGACAGAGGGAGGGGGG + Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119652692 14:76394855-76394877 ACGCAGAGCCAGAGGATGGCTGG + Intronic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1121317316 14:92970014-92970036 CAGCAGAGCCAGAAAAAGGCTGG + Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121744547 14:96278036-96278058 ATGCAGAGCCACAAGATGGAAGG + Intergenic
1122097809 14:99384231-99384253 ATTCAGGCCCAGAGGGAGGCGGG + Intergenic
1122354949 14:101117362-101117384 ATTCAGAGCCAGAAGGATCTGGG + Intergenic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124878957 15:33623849-33623871 GGGCATAGCCAGAGGGAGGCAGG - Exonic
1125781521 15:42273451-42273473 GAGCAGAGCCGGAAGAAGGCGGG - Exonic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127041835 15:54985323-54985345 ATGATGTTCCAGAAGGAGGCAGG - Intergenic
1128676235 15:69610999-69611021 ATGAAGAGCCTGGGGGAGGCAGG + Intergenic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1129957733 15:79654822-79654844 ATGCATGGCCACAAGGAGGAGGG - Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130631141 15:85570152-85570174 ATTCAGAGTGAGTAGGAGGCCGG + Intronic
1130706323 15:86236701-86236723 ATACAGAGACAGAGGGAGGGGGG + Intronic
1131006923 15:88985995-88986017 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1131018709 15:89079778-89079800 ATGCTGAGCTAGAAGAAGGAGGG - Intergenic
1132699380 16:1215855-1215877 GTGGAGAGCCAGAGGGATGCAGG + Intronic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1134174331 16:11993599-11993621 ATGATGAGCCTGAAGGAGGGAGG + Intronic
1134186350 16:12088023-12088045 AAGCAAAGCCAGAACGAGACAGG - Exonic
1134414992 16:14035282-14035304 AGGCACAGCCAGGAGGTGGCAGG + Intergenic
1134849397 16:17468680-17468702 ATGAAGAGAAGGAAGGAGGCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1136639635 16:31552715-31552737 ATCCAGAGCCTGGAGGGGGCTGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137740230 16:50763057-50763079 ATGCAGAGACAGAAGTAGACTGG - Intronic
1138588568 16:57986886-57986908 TTGAAGAGCATGAAGGAGGCCGG - Intronic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139341742 16:66271912-66271934 AACCAGAGCCAGAAGGAGAGGGG + Intergenic
1140092326 16:71848916-71848938 AAAAAGAGCCAGCAGGAGGCTGG + Intronic
1140766654 16:78165611-78165633 GAGCAGAGCCTGAAGGGGGCTGG + Intronic
1140887137 16:79254250-79254272 ATGTAGAGAGAGAAAGAGGCAGG - Intergenic
1142100066 16:88266208-88266230 ATGCAGGGCCACTGGGAGGCCGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143784365 17:9245615-9245637 ATGCAGAGTCACAAGGAAGCTGG + Intergenic
1144012371 17:11161845-11161867 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1144127962 17:12220450-12220472 GTACAGAGACAGAAGGAGGGGGG + Intergenic
1144154553 17:12486581-12486603 ATGTAGATCCAGAAGGACTCAGG - Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144304231 17:13952735-13952757 ATCCAGAGCCACAGGGTGGCTGG + Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1145239760 17:21233792-21233814 AGGCAGAGACAGATGGAGTCTGG - Intergenic
1145767129 17:27466482-27466504 ACCCAGGGCCAGGAGGAGGCAGG - Intronic
1146059563 17:29597321-29597343 CTGCAGGGCCAGAAGGCAGCTGG + Intronic
1146626126 17:34436879-34436901 GTGCTGAGCCAGGAGGTGGCAGG - Intergenic
1148044420 17:44733947-44733969 ATGTGTAGCCAGAAGGTGGCAGG + Intronic
1148094203 17:45041193-45041215 GTGAAGGGCCAGGAGGAGGCGGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149702876 17:58669929-58669951 ATGCAGAGCCTCAAGGAGCGTGG - Intronic
1150566832 17:66349512-66349534 ATGAAAAGCCAGAAGGAGAGAGG - Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151157409 17:72135556-72135578 AAGCAGAACTAGAAGGAGTCTGG + Intergenic
1151319448 17:73343687-73343709 AGGGAGGGCCAGAAGGAGGCAGG + Intronic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1152066219 17:78113905-78113927 AGGCAGAGCCAGTACGTGGCAGG - Intronic
1152318421 17:79594449-79594471 AGGCAGAGCCTGGAGGGGGCTGG - Intergenic
1153166462 18:2267188-2267210 AGGCAGAACAAGAAGGAGGGAGG + Intergenic
1153336942 18:3934470-3934492 ATGGAGAGAGAGAGGGAGGCAGG + Intronic
1153455799 18:5280828-5280850 TTGCAGAGCAAGTAGGAGGGAGG - Intergenic
1153797706 18:8640227-8640249 ATGGAGAGCTAGAAGTTGGCAGG + Intergenic
1153820065 18:8825158-8825180 AAGCAGAGCCAGAGGGAGCCCGG + Exonic
1153820522 18:8827654-8827676 ATTCAGAGCCCTAAGAAGGCAGG - Intronic
1153999247 18:10469805-10469827 ATGCAGAGTGAGCAAGAGGCTGG + Intronic
1154123308 18:11669287-11669309 ATACAGAGCCAGAGCGTGGCAGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157319562 18:46623846-46623868 AGGCAGAGCCATGAGGGGGCCGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1158770619 18:60512782-60512804 AAGTAGACCCAGGAGGAGGCTGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160952312 19:1673663-1673685 ATGCAGAGCTCTTAGGAGGCAGG + Intergenic
1162337182 19:10069154-10069176 ATGCAGACATGGAAGGAGGCAGG - Intergenic
1162967026 19:14160894-14160916 AGGCAAAGACAGAAGGGGGCAGG - Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164558402 19:29270714-29270736 ATGCTGAGCCAGAAAGATGGGGG + Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1164934862 19:32202397-32202419 CTGCAGAGCCTGCATGAGGCAGG - Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1165765486 19:38348035-38348057 ATTCAGAGCCAGAAGGGGTCAGG - Intronic
1167019389 19:46862165-46862187 AGGCAGAGTCAGAAGCAAGCAGG - Intergenic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167157766 19:47749953-47749975 GTGCTGGGCCAGCAGGAGGCAGG - Intronic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1202695162 1_KI270712v1_random:118170-118192 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
924959993 2:26265-26287 AGGCAGAGGCAGAAGGAGAGAGG + Intergenic
925065466 2:926194-926216 ATGCAGAGGCATTGGGAGGCTGG - Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925166713 2:1720068-1720090 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925166719 2:1720092-1720114 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925282865 2:2696919-2696941 ACCCAGAGCCAGGAGGAGTCTGG + Intergenic
925294429 2:2768021-2768043 AGGCAGAGCCTGCTGGAGGCCGG - Intergenic
925988498 2:9235020-9235042 AGGCAGAGCAAGCAGAAGGCTGG - Intronic
927197228 2:20556800-20556822 AGGCAGAACAAGAAGGAGCCAGG - Intergenic
927606317 2:24490579-24490601 TTGCAGAGCCAGAACGGGTCAGG + Intergenic
928480238 2:31675824-31675846 AGGCAAAGCCAGATGGGGGCTGG + Intergenic
930606042 2:53494119-53494141 GTGCAGAGCCAGAAGTGAGCTGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933608150 2:84405994-84406016 AAGCAAAGCCAGAAGAGGGCTGG - Intergenic
933983316 2:87571201-87571223 ATGCAAAGCCACAGGGAGGCTGG + Intergenic
934276332 2:91575219-91575241 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
936082287 2:109440658-109440680 AGGCAGTGGCAAAAGGAGGCAGG + Intronic
936310532 2:111379593-111379615 ATGCAAAGCCACAGGGAGGCTGG - Intergenic
936884564 2:117294595-117294617 AGGCAGACCCTGAAGGAGCCGGG - Intergenic
937167733 2:119836834-119836856 GGGCCGAGGCAGAAGGAGGCTGG - Intronic
937313484 2:120916413-120916435 TGGCAGAGCCAGAAGGAAGGGGG - Intronic
937380311 2:121370725-121370747 CTGCAGGGCCAGGAGGAGTCAGG - Intronic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
938669558 2:133573962-133573984 AACCAGAGCCTGGAGGAGGCAGG + Intergenic
939023890 2:136989179-136989201 ATGCCAAGCCAGAAGGAGAGGGG + Intronic
939899429 2:147833779-147833801 AGTCAAAGCCAGAAGGTGGCTGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941155403 2:161971745-161971767 CTTCAGTGCCAGAAGGAAGCTGG - Intronic
941178601 2:162231973-162231995 CTGCAGAGCCAGCAGGAAGATGG - Intronic
942098484 2:172555964-172555986 ACGCGGAGCGGGAAGGAGGCGGG - Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
944117651 2:196206754-196206776 AAGCAGAGCCAAAGGAAGGCTGG - Intronic
945395250 2:209307889-209307911 CTGCAGAGCCAGCAGGAGCTGGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946238559 2:218340347-218340369 ATGCAGAGCCAGAGGGCTGGGGG + Intronic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947094622 2:226551718-226551740 AAGCATAGCCAGAGGGAGGCAGG + Intergenic
947598441 2:231429138-231429160 ATACAGAGACAGAAGGAGGGGGG + Intergenic
948080422 2:235200978-235201000 AGGCAGAGGCAGAGGGCGGCAGG - Intergenic
948710846 2:239824643-239824665 AGCCAGAGCCAGAAGGAAGGGGG - Intergenic
949032212 2:241802549-241802571 AGGCGGGGCCAGAGGGAGGCCGG + Intronic
1168838247 20:892054-892076 ATGCAGGGAAAGAAGGAGGGGGG - Intronic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1169278994 20:4251230-4251252 GTGGAGAGCCAGCAGAAGGCTGG + Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1170577123 20:17672635-17672657 TTGCAGGACCAGAAGGAGGTAGG - Intronic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172015626 20:31870797-31870819 AGGCAGAGCCGGAAGGGGGACGG - Intronic
1172366697 20:34355604-34355626 ATGCAGAGCTGGAAGGAGTTGGG - Intergenic
1172464186 20:35143451-35143473 ATGCAAAGCTACAAAGAGGCTGG + Intronic
1172630491 20:36375113-36375135 ACGCAGAGCAAGTTGGAGGCAGG + Intronic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1173531164 20:43770662-43770684 ATGCAGAGTCAGAAACAGACAGG - Intergenic
1174020008 20:47522487-47522509 ATACAGAGACAGAAGGAGGGGGG + Intronic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175433051 20:58920703-58920725 ATACAGAGACAGAAGGAGGGGGG + Intergenic
1175615265 20:60393015-60393037 ATGCAGAGCATGAAGGATCCTGG - Intergenic
1175795273 20:61766918-61766940 GTGCAGAGTCAGAATCAGGCAGG - Intronic
1175944208 20:62551224-62551246 CTGCAGAGCCAGCAGCCGGCAGG + Intronic
1175950148 20:62579093-62579115 AGACAGAGACAGAGGGAGGCAGG - Intergenic
1175986013 20:62764508-62764530 AGCCAGAGCCAGGAGGAGGCCGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176100128 20:63361010-63361032 CCCCAGAGCCAGAGGGAGGCAGG - Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1179022967 21:37656560-37656582 CTGCAGAGCCATGGGGAGGCTGG - Intronic
1179166765 21:38941402-38941424 AGGCGGAGCCAGAAGCAGGAAGG - Intergenic
1181034793 22:20164738-20164760 CTGCTGAGACAGAAGGGGGCCGG - Intergenic
1181434056 22:22900170-22900192 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181434994 22:22905536-22905558 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181830725 22:25558395-25558417 ATGCAGATCCAGTTGGAGGCAGG - Intergenic
1182049168 22:27299915-27299937 AAGCAGGGCCAGACGGATGCTGG + Intergenic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182681019 22:32080182-32080204 AGGCAGAGCCAGGAGGTGGGAGG - Intronic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1184259762 22:43307932-43307954 TTGCTGGGCCAGAAGGGGGCTGG + Intronic
1184372980 22:44094447-44094469 AGGCAGAGGCAGAAGGAGCAGGG + Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1184824247 22:46936346-46936368 ATGCAGAACCACGAGGAGCCTGG - Intronic
1185080568 22:48707361-48707383 CTTGAGAGCCAGAAGAAGGCAGG - Intronic
1185144441 22:49123351-49123373 ATGGGCAGCCAGATGGAGGCTGG - Intergenic
1185399369 22:50607991-50608013 AGGCAGAGCCAGCCAGAGGCTGG + Intronic
949357890 3:3201313-3201335 GGGCAGGGCCAGAAGGAGGCTGG - Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
950066534 3:10116132-10116154 ATGCAGAGTACAAAGGAGGCAGG - Intronic
953232761 3:41079206-41079228 TGACAGAGCTAGAAGGAGGCCGG + Intergenic
954302277 3:49706341-49706363 TTGCAGAGTCAGCAGGAAGCAGG + Intronic
954397329 3:50299637-50299659 AGGCAGAGCCAGCTGGAGGCGGG - Intergenic
954672166 3:52297042-52297064 ACCCAGACCCAGAGGGAGGCAGG - Intergenic
954687006 3:52376560-52376582 AGGCAGGCCCAGGAGGAGGCTGG - Intronic
954932960 3:54299970-54299992 ATGCTGAGAGAGAAGGAGGTCGG - Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957937980 3:86968764-86968786 GGGCAGAGCCAGCAGGAGGGTGG + Exonic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
959391891 3:105785593-105785615 TTCCAGAGCCAGAAGAAGGAAGG - Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960509069 3:118526277-118526299 AGGCAGAGCTAGCAGGAGGATGG + Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962264423 3:133935131-133935153 AAGCAGAGCCAGAAGGAGAGAGG + Intronic
963047326 3:141112347-141112369 ATCAAAAGACAGAAGGAGGCCGG + Intronic
963290090 3:143478448-143478470 AGGCAGAGTCAGCAGGAGGCTGG + Intronic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965819072 3:172666479-172666501 ATACAGAGACAGAGGGAGGGGGG - Intronic
966305139 3:178523262-178523284 ATGAAGCTCCAAAAGGAGGCAGG + Intronic
968075654 3:195814753-195814775 ATGCAGACCCAGCAGTATGCGGG - Intergenic
968226374 3:196974916-196974938 ACGTAGAGCTAGAAGTAGGCAGG + Intergenic
968753316 4:2401552-2401574 TCACAGAGCCAGAAGGAGGAGGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969441633 4:7220496-7220518 AAGCAGGGCCAGATGGAGCCAGG + Intronic
969484780 4:7466264-7466286 GGGCAGAGCCACAAGGAGGCAGG - Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971240282 4:24882179-24882201 ATGCAAAGCCTGAAGGAAGATGG + Intronic
971255357 4:25009100-25009122 GTGCAGAGGCAGGAGGATGCAGG - Intronic
971457773 4:26860676-26860698 GTGGAGAGCCTGAGGGAGGCGGG + Intronic
971803256 4:31319671-31319693 AGGCAGAGCCACAAGAAGGAAGG - Intergenic
972312391 4:37892958-37892980 ATGCAGAGCCAGATGTGGGCGGG + Intronic
972462201 4:39315138-39315160 AGGCAGAGCCTGATGGAAGCGGG - Intronic
972617436 4:40713288-40713310 ATGCAGAGTTGGAGGGAGGCAGG + Intergenic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
976274027 4:83258055-83258077 AAGAAGAGCCAGAAGGCAGCAGG + Intergenic
977090601 4:92670674-92670696 ATGTAGAGCTACAAGGTGGCAGG + Intronic
978360929 4:107930995-107931017 ACGCAGAGACAGCAGGATGCTGG - Intergenic
979195589 4:117916735-117916757 AGGCAAAGCCAGATGGGGGCTGG + Intergenic
982702536 4:158672267-158672289 GCGCAGAGCGAGAAGGAGGTGGG + Exonic
983511144 4:168610706-168610728 TTGGAGAGCCAGAAGGTGGTTGG - Intronic
983781428 4:171674671-171674693 ATGTGGAGCCGGAAGGGGGCTGG - Intergenic
984888465 4:184472549-184472571 AGTCACAGCCATAAGGAGGCCGG + Intronic
984922455 4:184777794-184777816 AGACAGAGACAGAGGGAGGCAGG + Intronic
984941545 4:184936471-184936493 ATACAGAGACAGAGGGAGGGGGG - Intergenic
985009309 4:185566327-185566349 ATACAGAGACAGAGGGAGGGGGG + Intergenic
985347155 4:189018086-189018108 ATCAAGAGCCAGAAGCAGGTGGG + Intergenic
986240778 5:5957761-5957783 ATGCATAGCCAATAGCAGGCTGG - Intergenic
986249925 5:6046151-6046173 ATGCAGAGCCTGGAGCAGGAAGG - Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987087367 5:14483390-14483412 CTGCAGAGCCAGGAGGACCCTGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987370635 5:17189519-17189541 ATGCAGAGACAGAACGCGGTGGG - Intronic
987384709 5:17318360-17318382 ATTAAGAACCAGAAGAAGGCTGG + Intergenic
987507978 5:18798071-18798093 ATACAGAGACAGACGGAGGGAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
990878580 5:60516402-60516424 ATGGAGAGCCAGACAGAGACAGG - Intronic
992115142 5:73532364-73532386 ATGCTGATCTGGAAGGAGGCGGG + Intergenic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993128411 5:83863986-83864008 AGGCAGAGCCAGAAGTAGATCGG - Intergenic
994926274 5:106120949-106120971 GAGCAGAGCCAGAAGGCGGGAGG - Intergenic
995685201 5:114765206-114765228 TTGGAGTGCCAGAAGGAGACAGG - Intergenic
996676680 5:126183335-126183357 ATGCTGAACCAAAAGGAAGCTGG + Intergenic
997042918 5:130278460-130278482 CTGCAGAGCCAGCAGGAGCCAGG - Intergenic
997725435 5:136116509-136116531 ATGCAGAGCATGGAGGAGGGAGG + Intergenic
998139216 5:139690467-139690489 ATTCTGAGGCAGAGGGAGGCAGG - Intergenic
998564885 5:143208015-143208037 ACACAGAGACAGAAGCAGGCTGG - Intronic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999374210 5:151075687-151075709 CTGCAGAGACAGAAGTGGGCTGG + Intronic
999906777 5:156149735-156149757 ATGCCCTGCCTGAAGGAGGCTGG + Intronic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1001405830 5:171476820-171476842 AAGCAGAGACACAAGGAGACTGG - Intergenic
1001525658 5:172426806-172426828 AAGCAGAGCCAGAGGGAGAGAGG + Intronic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002564413 5:180101727-180101749 ACGCCGAGCAAGAAGGAGGTGGG + Intronic
1002614085 5:180439565-180439587 GCACAGAGCCAGCAGGAGGCGGG - Intergenic
1002641434 5:180632397-180632419 AGGGAGAGCCCGGAGGAGGCTGG - Intronic
1002714556 5:181218450-181218472 ACGCAGGGCCACAAGGAGACTGG - Intergenic
1003166108 6:3679933-3679955 AAGCAGAGCCTGCAGGAGCCAGG - Intergenic
1003960398 6:11203798-11203820 AGGCAGGGACACAAGGAGGCAGG - Intronic
1005047226 6:21653867-21653889 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1005970342 6:30756036-30756058 ATGCTGAGCCACAAGGAGTCTGG - Intergenic
1006034546 6:31201334-31201356 GTGCAGAGCCAGAAGCAGCCAGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007341219 6:41192578-41192600 AGGCAGAGCCAGAAAGGGGCTGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007412665 6:41673950-41673972 CTGCAGAGCCAGGAGAAGGGAGG + Intergenic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1008741709 6:54616284-54616306 TTGGAGTGCCAGAAGGAGACAGG + Intergenic
1009307104 6:62103671-62103693 CTGCAGAGCCACAGGGAGCCAGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010192373 6:73207553-73207575 AACCAGAGACAGGAGGAGGCAGG + Intergenic
1010815785 6:80356882-80356904 AGGCAGAGGCAGAAGGAGTCGGG - Intergenic
1010959676 6:82131682-82131704 ATGCACAGCTAGAGAGAGGCTGG + Intergenic
1010974875 6:82300705-82300727 ATGCAAAGCCAGAAGGTTGCAGG + Intergenic
1011578252 6:88827982-88828004 CTTCAGAGCCAGTAGTAGGCAGG - Intronic
1011677724 6:89751556-89751578 TTCCAGAGCCAAAAGGAGGTCGG - Exonic
1011821678 6:91260561-91260583 GTGGAGTGCCAGAAGAAGGCAGG + Intergenic
1013067073 6:106694320-106694342 AGGCAGAGACAAGAGGAGGCAGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014279854 6:119429692-119429714 AGGCAGAGACAGAGAGAGGCTGG + Intergenic
1016360041 6:143257930-143257952 ATGCTGAGCCTGAGGGTGGCAGG - Intronic
1017047922 6:150364652-150364674 ATCCACATCAAGAAGGAGGCAGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017070201 6:150569364-150569386 ATGAGGTGCCAGAATGAGGCTGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017814830 6:158009277-158009299 AGGCACAGCCAGGAAGAGGCGGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018126877 6:160690778-160690800 ATTCAGAGCAAGAAGGGTGCAGG - Intergenic
1018739545 6:166717006-166717028 ATCCGGAGCCAGAAGGAGCAGGG + Intronic
1018891835 6:167988310-167988332 AGCCAGAGGCAGGAGGAGGCAGG + Intergenic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1020260754 7:6529597-6529619 ATGGAGGGCCAGCAGGAGCCAGG - Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1021176985 7:17460634-17460656 ATACAGAGACAGAGGGAGGGAGG + Intergenic
1021633018 7:22665226-22665248 CTGCAGCGCCCGGAGGAGGCGGG - Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023749939 7:43362748-43362770 AGGCAGAGAAGGAAGGAGGCAGG + Intronic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024224472 7:47315145-47315167 AGGCCGAGCCAGCAGGATGCTGG - Intronic
1024865378 7:53899943-53899965 TTGCAGAGGCTGCAGGAGGCAGG - Intergenic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027052675 7:75029767-75029789 AGGCAGAGCCTGAGTGAGGCCGG + Intronic
1027220564 7:76211266-76211288 AGGCAGAGGCACAAGGAGGCAGG + Intronic
1028615838 7:92765960-92765982 ATGCCGAGCTAGAAGCAAGCTGG + Intronic
1029020464 7:97359602-97359624 ATCCAGAGACAGAAGGAACCTGG + Intergenic
1029421154 7:100472483-100472505 AGACAGAGACAGCAGGAGGCTGG + Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029679619 7:102099235-102099257 CTGCAAAGCCAGAAAGAAGCGGG - Intronic
1032550272 7:132778312-132778334 AACCAGAGCCAGAACAAGGCAGG - Intergenic
1032631833 7:133661590-133661612 ATACAGAGACAAAAGGAGGGGGG - Intronic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1035269919 7:157713218-157713240 ATGCAGTGCTAGGAGGAGGAGGG - Intronic
1035459141 7:159028725-159028747 ATGTGGAGCGAGAGGGAGGCAGG - Exonic
1035970744 8:4245409-4245431 ATGCAAAGGGAGGAGGAGGCAGG + Intronic
1036098848 8:5755525-5755547 AGGCAGAGTTAGAAGGAGGCAGG + Intergenic
1036512948 8:9417543-9417565 CTGAAGGGCCAGCAGGAGGCTGG - Intergenic
1037648040 8:20811578-20811600 AGGCAGAGACAGATGGAGGGTGG + Intergenic
1038448423 8:27620789-27620811 AGGGAGAGCCAGAGGGAGGGAGG - Intergenic
1038739286 8:30202709-30202731 AAGCAGAGACAAAAGGAGTCTGG + Intergenic
1038921682 8:32091812-32091834 GTGCAGAGCCAGAACAAGGGAGG + Intronic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1040899604 8:52404378-52404400 CTGCTGAGACAGAAGGAGTCGGG + Intronic
1041012442 8:53558443-53558465 ATGCAGAGCTACAAGGAGATTGG + Intergenic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1044942397 8:97356613-97356635 ATGCAGAGCCAGACACTGGCGGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047184094 8:122616444-122616466 ATGTGGTGACAGAAGGAGGCAGG - Intergenic
1047333221 8:123911560-123911582 ATGCAGAGCCAGAAAGACCTAGG - Intronic
1047521772 8:125600485-125600507 AGGCAGAGCAGAAAGGAGGCTGG - Intergenic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1049079636 8:140431704-140431726 ATGCAGAGCGAGGAGGTGGGGGG + Intronic
1049108298 8:140627113-140627135 ATGCAGGGCGGGAAGGTGGCGGG - Intronic
1049158766 8:141084230-141084252 ATGCAGAGTCAGAAGTAGCTGGG + Intergenic
1049176449 8:141195469-141195491 ATGCAGACCCAACCGGAGGCCGG - Exonic
1049611855 8:143559571-143559593 AGGCAGAGCCCCAGGGAGGCTGG + Intronic
1049671981 8:143873949-143873971 ATGCAGGGCCAGGCTGAGGCAGG - Intronic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1049850866 8:144829415-144829437 AGGCAGCGCCAGAAGGGGGCTGG + Intronic
1050565943 9:6883762-6883784 AGGCAGAGCCAGAAGAATCCTGG + Intronic
1054884998 9:70186823-70186845 AGACAGAGCAAGAGGGAGGCAGG + Intronic
1056086491 9:83154720-83154742 ATGCAAAGACAGAAAAAGGCAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058877694 9:109258782-109258804 AGGCAGAGCGAGAGGGAGGCAGG + Intronic
1058935176 9:109763379-109763401 TTGCAAAGCAAGTAGGAGGCAGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1059419801 9:114183773-114183795 AGACAGAGCCAGGGGGAGGCTGG + Intronic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060202920 9:121662292-121662314 ATTCAGGTCCAGAAGGAGTCAGG + Intronic
1060229765 9:121818098-121818120 ATGCAGAGTTGAAAGGAGGCTGG + Intergenic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060584882 9:124779747-124779769 CTGCAGAGCCAGCAGGAGTCTGG - Intronic
1061234449 9:129334454-129334476 ATGCAGAGCTAGGAGGAGGGCGG + Intergenic
1061297589 9:129685277-129685299 ATGCGGAGCCAAAAGCAGGGTGG + Intronic
1061421510 9:130475212-130475234 ATGCAGAATGAGGAGGAGGCTGG + Intronic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1061958699 9:133977120-133977142 TTCCAGAGCTGGAAGGAGGCAGG - Intronic
1062028760 9:134352569-134352591 AAGCGGGGCCAGCAGGAGGCTGG - Intronic
1062215011 9:135384428-135384450 ATGCCGAGCCTGCTGGAGGCTGG - Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062413155 9:136434732-136434754 ATGCAGGGCCAGAAGGTGAGTGG - Exonic
1062540271 9:137038942-137038964 ATGCAGAGCCAGGTGGACCCAGG - Intergenic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186216282 X:7304725-7304747 ATGGAGAGCCACTTGGAGGCAGG - Intronic
1186814964 X:13227323-13227345 ATGCAGGGCCAGAAGTGGCCTGG - Intergenic
1187034285 X:15521642-15521664 CTGCAGAACCAGAAGGTTGCAGG + Intronic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187283534 X:17881315-17881337 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1187357939 X:18595859-18595881 AAGTAGAGCCAGAAAGAGTCTGG - Intronic
1188007588 X:25026758-25026780 ATGCAGAGCTAAAAGAGGGCAGG + Intergenic
1188095606 X:26017391-26017413 CTGCAGAGCCAGCAGGAGTGAGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190538813 X:51456616-51456638 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1191936197 X:66429621-66429643 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192760151 X:74088164-74088186 ATGCAGAGCTACATGGAGTCTGG + Intergenic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1193348902 X:80434264-80434286 ATTCAGACCTACAAGGAGGCAGG - Intronic
1194247668 X:91536033-91536055 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1194884501 X:99296267-99296289 ATGCAGGTCTAGAAGGAGTCAGG - Intergenic
1196263045 X:113608304-113608326 ATGCAGAGCCAGAAGTACCTGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198691981 X:139294369-139294391 AGGCAAAGGCAGTAGGAGGCAGG + Intergenic
1198963847 X:142207722-142207744 AGGAAGGGCTAGAAGGAGGCAGG - Intergenic
1199018648 X:142848787-142848809 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1199882503 X:151985820-151985842 ATGAAGAGCCAGAAGAGAGCTGG + Intergenic
1200566688 Y:4777563-4777585 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200916041 Y:8572090-8572112 ATGGAGAGACAGTAGGAGTCCGG + Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic