ID: 1046790745

View in Genome Browser
Species Human (GRCh38)
Location 8:118319203-118319225
Sequence GTCACCTCCATTAATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046790736_1046790745 26 Left 1046790736 8:118319154-118319176 CCAGAAACATAAACTTGTACAAG 0: 1
1: 0
2: 0
3: 14
4: 239
Right 1046790745 8:118319203-118319225 GTCACCTCCATTAATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046790745 Original CRISPR GTCACCTCCATTAATGGGGG TGG Intronic
No off target data available for this crispr