ID: 1046793468

View in Genome Browser
Species Human (GRCh38)
Location 8:118346033-118346055
Sequence CAGAATAAACAGATGCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 757}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046793468_1046793474 28 Left 1046793468 8:118346033-118346055 CCTTGGTGCATCTGTTTATTCTG 0: 1
1: 0
2: 2
3: 31
4: 757
Right 1046793474 8:118346084-118346106 TCGAGGGATGTCACAGGCTCCGG No data
1046793468_1046793469 -8 Left 1046793468 8:118346033-118346055 CCTTGGTGCATCTGTTTATTCTG 0: 1
1: 0
2: 2
3: 31
4: 757
Right 1046793469 8:118346048-118346070 TTATTCTGTAAAATGAACTCAGG No data
1046793468_1046793471 11 Left 1046793468 8:118346033-118346055 CCTTGGTGCATCTGTTTATTCTG 0: 1
1: 0
2: 2
3: 31
4: 757
Right 1046793471 8:118346067-118346089 CAGGGAAATCATAATTATCGAGG No data
1046793468_1046793473 22 Left 1046793468 8:118346033-118346055 CCTTGGTGCATCTGTTTATTCTG 0: 1
1: 0
2: 2
3: 31
4: 757
Right 1046793473 8:118346078-118346100 TAATTATCGAGGGATGTCACAGG No data
1046793468_1046793472 12 Left 1046793468 8:118346033-118346055 CCTTGGTGCATCTGTTTATTCTG 0: 1
1: 0
2: 2
3: 31
4: 757
Right 1046793472 8:118346068-118346090 AGGGAAATCATAATTATCGAGGG No data
1046793468_1046793470 -7 Left 1046793468 8:118346033-118346055 CCTTGGTGCATCTGTTTATTCTG 0: 1
1: 0
2: 2
3: 31
4: 757
Right 1046793470 8:118346049-118346071 TATTCTGTAAAATGAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046793468 Original CRISPR CAGAATAAACAGATGCACCA AGG (reversed) Intronic
900346042 1:2210700-2210722 CAGAGCACACACATGCACCAGGG + Intronic
901951240 1:12748730-12748752 GAGAATAAACACAAGCATCAAGG + Intronic
902966087 1:20003923-20003945 CATAATAGTCAGATTCACCAAGG + Intergenic
906627607 1:47337955-47337977 CAAAATAAAGAGATTCACAAAGG - Intronic
907015363 1:51006916-51006938 CATAATCATCAGATTCACCAAGG + Intergenic
907328462 1:53656167-53656189 CATAATCAGCAGATGCACCTAGG + Intronic
907565814 1:55432259-55432281 CATAATCATCAGATTCACCAAGG + Intergenic
909384408 1:75038347-75038369 CATAATCATCAGATTCACCAAGG + Intergenic
909403471 1:75259720-75259742 CACAATCATCAGATTCACCAAGG + Intronic
909689974 1:78396690-78396712 CATAATCATCAGATTCACCAAGG - Intronic
910177381 1:84444763-84444785 CATAATCATCAGATTCACCAAGG + Intergenic
910681430 1:89869649-89869671 CATAATCATCAGATTCACCAAGG + Intronic
910799706 1:91132920-91132942 CATAATCATCAGATTCACCAAGG + Intergenic
910912706 1:92254458-92254480 CATAATCATCAGATTCACCAAGG + Intronic
910940791 1:92531478-92531500 CATAATCATCAGATTCACCAAGG + Intronic
911081133 1:93932421-93932443 CAGAATAAACAGACAACCCACGG + Intergenic
911691876 1:100844090-100844112 CATAATCATCAGATTCACCAAGG - Intergenic
911938406 1:104010623-104010645 CATAATCATCAGATTCACCAAGG - Intergenic
912636346 1:111297265-111297287 CATAATAGTCAGATTCACCAAGG + Intronic
913108484 1:115637919-115637941 CATAATCATCAGATTCACCAAGG - Intergenic
914211348 1:145582254-145582276 CATAATTATCAGATTCACCAAGG + Intergenic
914966963 1:152268596-152268618 CATAATCATCAGATTCACCAAGG - Intergenic
914969409 1:152293521-152293543 CATAATCATCAGATTCACCAAGG + Intergenic
915077178 1:153318735-153318757 CATAATCATCAGATTCACCAAGG - Intergenic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
918360213 1:183750010-183750032 CATAATCATCAGATTCACCAAGG - Intronic
918612654 1:186510863-186510885 CATAATCATCAGATTCACCAAGG - Intergenic
919146603 1:193643840-193643862 CATAATCATCAGATTCACCAAGG - Intergenic
919223341 1:194660570-194660592 CATAATCATCAGATTCACCAAGG + Intergenic
919602076 1:199634539-199634561 CATAATCATCAGATTCACCAAGG + Intergenic
920428851 1:205901114-205901136 CATAATAGTCAGATTCACCAAGG + Intergenic
921922460 1:220685131-220685153 CAGCATAAACAGTTGAAGCATGG - Intergenic
921976504 1:221208591-221208613 CATAATAGTCAGATTCACCAAGG + Intergenic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
922650893 1:227337381-227337403 CTGAATAAAGACATGCAGCAAGG + Intergenic
922716188 1:227873844-227873866 CATAATCATCAGATTCACCAAGG + Intergenic
923081222 1:230657517-230657539 CATAATCATCAGATTCACCAAGG - Intronic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924276274 1:242390551-242390573 TAGAATAAACAATTACACCAAGG - Intronic
924559379 1:245144785-245144807 CACAATACACATATACACCATGG - Intergenic
924635395 1:245782425-245782447 CAAAATAAACAGATTCCCAAAGG - Intronic
924878391 1:248130343-248130365 CATAATCAACAGATTCTCCAAGG + Intergenic
1062775699 10:145346-145368 CACAATAAACATATGCACGCAGG + Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064981619 10:21172690-21172712 CGCAATACACAGACGCACCATGG + Intronic
1065119205 10:22512676-22512698 CATAATCATCAGATTCACCAAGG - Intergenic
1065337259 10:24665604-24665626 CAGAATAAAAAGGAGCACAAGGG + Intronic
1065427601 10:25621196-25621218 CATAATCATCAGATTCACCAAGG + Intergenic
1065621779 10:27589002-27589024 CATAATAGCCAGATTCACCAAGG + Intergenic
1066042749 10:31567261-31567283 CATAATTATCAGATTCACCAAGG - Intergenic
1066257473 10:33694748-33694770 CATAATCATCAGATTCACCAAGG - Intergenic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068004886 10:51381162-51381184 CAGAATAATCAGTTGAACCCAGG + Intronic
1068085915 10:52373677-52373699 CATAATCATCAGATTCACCAAGG - Intergenic
1069042767 10:63712099-63712121 CAGGAAAAACACAGGCACCATGG - Intergenic
1069093305 10:64228436-64228458 CATAATCATCAGATTCACCAAGG - Intergenic
1069139764 10:64808895-64808917 CATAATCATCAGATTCACCAAGG - Intergenic
1069294803 10:66830534-66830556 CAGCATAAACCAATGCAGCATGG + Intronic
1071066574 10:81643398-81643420 CACAATTGTCAGATGCACCAAGG - Intergenic
1071341120 10:84650106-84650128 CATAATCATCAGATTCACCAAGG - Intergenic
1071354444 10:84779370-84779392 CAGAATAAACAAATGACCTACGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072045061 10:91645851-91645873 CATAATCATCAGATTCACCAAGG + Intergenic
1072365175 10:94702185-94702207 CACAATCATCATATGCACCAAGG - Intronic
1072876361 10:99176811-99176833 CATAATGATCAGATTCACCAAGG + Intronic
1073541459 10:104319043-104319065 AAGACTCAACAGAAGCACCAGGG + Intronic
1073746020 10:106468880-106468902 CATAATTATCAGATTCACCAAGG + Intergenic
1073864203 10:107783844-107783866 CACAATCATCAGATTCACCAAGG - Intergenic
1074016574 10:109541032-109541054 CACAATCATCAGATTCACCAAGG - Intergenic
1074295334 10:112182776-112182798 GAGAATAAACCAATGCACCTGGG + Exonic
1074297900 10:112208092-112208114 CAGGATAACCACATGCATCAGGG + Intronic
1074595112 10:114856443-114856465 CACAATAAACTGATGCATCCTGG - Intronic
1076262635 10:129079789-129079811 CAGCATTAACAAATGCCCCAGGG - Intergenic
1077052393 11:573169-573191 CATAATAAACACATGCACCCAGG - Intergenic
1077094654 11:794199-794221 GAGAAGAGACAGATGTACCATGG + Intronic
1077260130 11:1613239-1613261 GAGAATGAAAAGATGAACCAAGG - Intergenic
1077355158 11:2113023-2113045 CAAAATAAACAAATGCACCGTGG + Intergenic
1077696610 11:4398548-4398570 CACAATAGTCAGATTCACCAAGG + Intergenic
1078636580 11:13056051-13056073 CTGAATAAACTGATATACCAGGG - Intergenic
1078686015 11:13533112-13533134 CATAATCATCAGATTCACCAAGG - Intergenic
1078889095 11:15537853-15537875 AAAAATAAACAGTTTCACCAAGG - Intergenic
1079050404 11:17151633-17151655 AAGAAAAAACAGAAGCAACAAGG - Intronic
1079550934 11:21696469-21696491 CATAATCATCAGATTCACCAAGG + Intergenic
1080118113 11:28642947-28642969 CATAATCATCAGATTCACCAAGG + Intergenic
1080153741 11:29083483-29083505 CAGAATAAACAAATGCCTTAAGG - Intergenic
1080235695 11:30066087-30066109 CATAATTATCAGATTCACCAAGG - Intergenic
1080965453 11:37209555-37209577 CATAATAATCAGATTCACCAAGG - Intergenic
1080977320 11:37358256-37358278 CATAATCATCAGATACACCAAGG + Intergenic
1081523395 11:43905189-43905211 CAAAATAAACAGCTGCTGCAAGG - Intronic
1082182751 11:49140348-49140370 CATAATCATCAGATTCACCAAGG + Intergenic
1082670877 11:56034802-56034824 CATAATCATCAGATTCACCAAGG + Intergenic
1082903449 11:58281758-58281780 CATAATCATCAGATTCACCAAGG - Intergenic
1082924559 11:58531748-58531770 CATAATCATCAGATTCACCAAGG + Intronic
1083385350 11:62305084-62305106 CATAATTATCAGATTCACCAAGG - Intergenic
1083891701 11:65598766-65598788 TACAAAAAACAGAGGCACCACGG - Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086085867 11:82954814-82954836 CATAATCATCAGATTCACCAAGG - Intronic
1086117465 11:83267799-83267821 CATAATTATCAGATTCACCAAGG + Intronic
1086253872 11:84850674-84850696 TAGAATAAACAGATTCAGCAAGG + Intronic
1086363515 11:86084518-86084540 AGGAATAAACAGATCCAGCAGGG - Intergenic
1086532186 11:87799634-87799656 CATAATCATCAGATTCACCAAGG - Intergenic
1086732651 11:90269509-90269531 CATAATCATCAGATTCACCAAGG - Intergenic
1087328830 11:96754556-96754578 CAGAATCATCAGATTCTCCAAGG - Intergenic
1087339360 11:96882956-96882978 CAGAGTAAACAGATAACCCACGG - Intergenic
1087596301 11:100258478-100258500 CATAATCATCAGATTCACCAAGG + Intronic
1087703616 11:101465238-101465260 CATAATCATCAGATTCACCAAGG - Intronic
1087749203 11:101988040-101988062 CAGAATAAACAGACCCAGAAAGG + Intronic
1087868430 11:103262391-103262413 CATAATCATCAGATTCACCAAGG + Intronic
1087887946 11:103502188-103502210 CATAATAATCAGATTCACCAGGG + Intergenic
1087898436 11:103613030-103613052 CATAATCATCAGATTCACCAAGG + Intergenic
1088066630 11:105727566-105727588 CATAATCATCAGATTCACCAAGG + Intronic
1088294293 11:108275814-108275836 CATAATCATCAGATTCACCAAGG - Intronic
1088656819 11:112007497-112007519 CATAATTATCAGATTCACCAAGG + Intronic
1089441282 11:118519594-118519616 TAGAAGAATCAGAAGCACCAGGG - Intronic
1090928296 11:131272203-131272225 CATAATCATCAGATTCACCAAGG - Intergenic
1090985969 11:131766421-131766443 CAGCAAAATCAGATGCACCGAGG + Intronic
1092126847 12:6080592-6080614 GAGAAGAAACAGAGTCACCACGG + Intronic
1092304534 12:7285246-7285268 CATAATCATCAGATTCACCAAGG + Intergenic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1092423450 12:8353703-8353725 CAGAGTAAACAGATCACCCACGG - Intergenic
1092513699 12:9185624-9185646 CACAATCATCAGATTCACCAAGG + Intronic
1092639073 12:10483366-10483388 CATAATCATCAGATTCACCAAGG + Intergenic
1092691070 12:11110358-11110380 CATAATAGTCAGATTCACCAAGG + Intronic
1093248792 12:16773501-16773523 CATAATCATCAGATTCACCAAGG - Intergenic
1093714679 12:22367629-22367651 CATAATTATCAGATTCACCAAGG + Intronic
1093904829 12:24678054-24678076 GAGAACACAGAGATGCACCATGG - Intergenic
1094060900 12:26314765-26314787 CATAATCATCAGATTCACCAAGG - Intergenic
1094139867 12:27170321-27170343 CATAATCATCAGATTCACCAAGG - Intergenic
1094817162 12:34199464-34199486 CAGAACACACATATGCACCATGG + Intergenic
1095099858 12:38169250-38169272 CAGAACACACATATGCACCATGG - Intergenic
1095185497 12:39196483-39196505 CATAATTATCAGATTCACCAAGG - Intergenic
1095547182 12:43386436-43386458 CATAATTGACAGATTCACCAAGG - Intronic
1095695038 12:45134152-45134174 CATAATCATCAGATTCACCAAGG + Intergenic
1096015948 12:48274885-48274907 CATAATCATCAGATTCACCAAGG - Intergenic
1096604501 12:52754947-52754969 CAGAATCAACAGAGCCACCCAGG - Intergenic
1096801428 12:54113016-54113038 CAGAATAAAAAGATTCTTCAAGG + Intergenic
1096894867 12:54811402-54811424 CATAATCATCAGATTCACCAGGG - Intergenic
1096950247 12:55460991-55461013 CATAATTATCAGATTCACCAAGG + Intergenic
1097435395 12:59547851-59547873 CATAATCATCAGATTCACCAAGG - Intergenic
1097460649 12:59857822-59857844 CATAATCATCAGATTCACCAAGG + Intergenic
1098680695 12:73349804-73349826 CACAATCATCAGATTCACCAAGG - Intergenic
1098906483 12:76168340-76168362 CATAATCATCAGATTCACCAAGG - Intergenic
1099035476 12:77582102-77582124 CAAAATAAAAAGATGCAACCTGG - Intergenic
1099088416 12:78276417-78276439 CATAATCATCAGATTCACCAAGG - Intergenic
1099235935 12:80082718-80082740 CATAATCATCAGATCCACCAAGG - Intergenic
1099344378 12:81479857-81479879 CATAATCATCAGATTCACCAAGG - Intronic
1099697311 12:86039170-86039192 CATAATCATCAGATTCACCAAGG - Intronic
1099767554 12:87007252-87007274 CAGAGTCATCAGATTCACCAAGG - Intergenic
1099797634 12:87419602-87419624 CATAATCAGCAGATTCACCAAGG - Intergenic
1100111233 12:91244248-91244270 CATAATCATCAGATGCACTAAGG + Intergenic
1100374980 12:94006757-94006779 CATAATTATCAGATTCACCAAGG - Intergenic
1100417301 12:94391167-94391189 CATAATTTTCAGATGCACCAAGG + Intronic
1100593259 12:96049281-96049303 CAGAACGAAAAGACGCACCATGG + Intergenic
1100996100 12:100302702-100302724 CATAATTATCAGATTCACCAAGG - Intronic
1101352325 12:103943013-103943035 TAGGATAAACAAATACACCAGGG + Intronic
1101472492 12:105011941-105011963 CATAATCATCAGATTCACCAAGG - Intronic
1101487826 12:105183708-105183730 CATAATCATCAGATTCACCAAGG - Intronic
1102312176 12:111854332-111854354 CAAAATAATCAGTTGAACCAGGG - Intronic
1102323616 12:111959038-111959060 CAAAATCATCAGATTCACCAAGG + Intronic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1104255337 12:127131294-127131316 CAAAATAAAAACATCCACCAGGG - Intergenic
1105201526 13:18183868-18183890 CAGAATTGTCAGATTCACCAAGG + Intergenic
1106042372 13:26105215-26105237 CATAATCATCAGATTCACCAAGG + Intergenic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106326164 13:28692521-28692543 CAAAATGATCAGATTCACCAAGG - Intergenic
1106334913 13:28775360-28775382 CATAATCATCAGATTCACCAAGG - Intergenic
1106378638 13:29214811-29214833 CATAATCATCAGATTCACCAAGG - Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107259123 13:38470256-38470278 GAAAATAAACAGAAGCATCAAGG - Intergenic
1107673902 13:42775395-42775417 CATAATCATCAGATTCACCAAGG - Intergenic
1108048638 13:46407514-46407536 CATAATCATCAGATTCACCAAGG - Intronic
1108217867 13:48202547-48202569 CATAATTATCAGATTCACCAAGG + Intergenic
1108220303 13:48227068-48227090 CATAAAAGACATATGCACCAAGG - Intergenic
1108262617 13:48674073-48674095 CATAATCATCAGATTCACCAGGG - Intronic
1108841968 13:54628846-54628868 CAAAACAGACAGATGCTCCATGG - Intergenic
1109034021 13:57231616-57231638 CACAATCATCAGATTCACCAAGG + Intergenic
1109174119 13:59134237-59134259 AAGAAGACACAGAAGCACCATGG - Intergenic
1109196095 13:59378806-59378828 CATAATGATCAGATTCACCAAGG + Intergenic
1109293834 13:60506072-60506094 CATAATCATCAGATTCACCAAGG + Intronic
1109328815 13:60902021-60902043 CATAATCATCAGATTCACCAAGG + Intergenic
1109495990 13:63172571-63172593 AAGAATAAAGAGATGCTACATGG + Intergenic
1109541170 13:63780859-63780881 CATAATCATCAGATTCACCAAGG - Intergenic
1109626486 13:64981553-64981575 CATAATCATCAGATTCACCAAGG - Intergenic
1109635367 13:65108343-65108365 CATAATCATCAGATTCACCAAGG - Intergenic
1110067745 13:71130004-71130026 CATAATCATCAGATTCACCAAGG + Intergenic
1110621157 13:77597304-77597326 CAGAAAAAACAAATGCTGCAAGG + Intronic
1110757106 13:79188353-79188375 CAGCAGAAAGAGATGCACCATGG + Intergenic
1110826481 13:79976714-79976736 CATAATAGTCAGATTCACCAAGG + Intergenic
1111114380 13:83756067-83756089 CATAATCATCAGATTCACCAAGG + Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1112948662 13:104962464-104962486 CAGAATAAGAAGATGGACCGTGG - Intergenic
1113410156 13:110078823-110078845 CATAATCATCAGATTCACCAAGG + Intergenic
1114636926 14:24192868-24192890 CAGTAAAAACACAAGCACCATGG + Exonic
1114784788 14:25584503-25584525 CATAATTGACAGATTCACCAAGG - Intergenic
1114845068 14:26310607-26310629 CATAATCATCAGATTCACCAAGG + Intergenic
1115048523 14:29027830-29027852 CATAATCATCAGATTCACCAAGG - Intergenic
1115281338 14:31667003-31667025 CATAATCATCAGATTCACCAAGG - Intronic
1115538235 14:34393204-34393226 CATAATCATCAGATTCACCAAGG + Intronic
1115810660 14:37103423-37103445 CAGAATAAATATAGTCACCATGG + Intronic
1115818599 14:37189472-37189494 CATAATCATCAGATTCACCAAGG + Intergenic
1115842567 14:37488889-37488911 CATAATCATCAGATTCACCAGGG - Intronic
1116227451 14:42170492-42170514 CATAATTAACAGATTCACCAAGG - Intergenic
1116775892 14:49180161-49180183 CATAATCATCAGATTCACCAAGG + Intergenic
1116792352 14:49353009-49353031 CATAATCATCAGATTCACCAAGG - Intergenic
1116792882 14:49358267-49358289 CATAATCATCAGATTCACCAAGG + Intergenic
1117204323 14:53425452-53425474 CATAATCATCAGATTCACCAAGG + Intergenic
1117238144 14:53799862-53799884 CATAATCATCAGATTCACCAAGG + Intergenic
1117466334 14:55998514-55998536 CATAATCATCAGATTCACCAAGG - Intergenic
1117616907 14:57543543-57543565 CATAATCATCAGATTCACCAAGG - Intergenic
1117930362 14:60835684-60835706 CATAATCATCAGATTCACCAAGG - Intronic
1117954297 14:61110909-61110931 CAGAATAAAAATAGGCCCCAGGG + Intergenic
1118494803 14:66297473-66297495 CATAATCATCAGATTCACCAAGG + Intergenic
1120770271 14:88371567-88371589 CATAATCATCAGATTCACCAAGG + Intergenic
1120903704 14:89600407-89600429 CAGATTAATCTGATGCCCCATGG + Intronic
1121470568 14:94151131-94151153 CATAATCATCAGATTCACCAAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121899157 14:97676254-97676276 CATAATCATCAGATTCACCAAGG + Intergenic
1122168164 14:99846581-99846603 AAGAATAAAAATATTCACCAGGG - Intronic
1202842691 14_GL000009v2_random:137510-137532 CAAAATCATCAGATTCACCAAGG - Intergenic
1202880531 14_KI270722v1_random:54878-54900 CAAAATCATCAGATTCACCAAGG + Intergenic
1124797058 15:32792053-32792075 CAGAAGAAACAGAGGAACTAAGG + Intronic
1124810338 15:32930690-32930712 CAAAAATAACAGATGCACAAAGG - Intronic
1125288691 15:38121420-38121442 CATAATCATCAGATTCACCATGG + Intergenic
1125329825 15:38572040-38572062 CATAATCATCAGATTCACCAAGG - Intergenic
1125453696 15:39835755-39835777 CAGAATAAAGACAGGCTCCATGG - Intronic
1125984903 15:44040355-44040377 CATAATAGTCAGATTCACCAGGG + Intronic
1126051006 15:44684787-44684809 CATAATCATCAGATCCACCAAGG + Intronic
1126418946 15:48450822-48450844 CATTTTAAACAGATGCACAAAGG + Intronic
1126952030 15:53892326-53892348 CACAATCATCAGATTCACCAAGG - Intergenic
1127119999 15:55763256-55763278 CAGAAGAATCAGATGAACCCGGG + Intergenic
1127452404 15:59129990-59130012 CATAATCATCAGATTCACCAAGG - Intergenic
1127621249 15:60736855-60736877 GAGAATAAATAGATACACCTTGG + Intronic
1128852338 15:70972435-70972457 CATAATCATCAGATACACCAAGG - Intronic
1129563393 15:76594517-76594539 CATAATCATCAGATTCACCAAGG + Intronic
1129626136 15:77201957-77201979 CAGATGAATCAGATGCACAAAGG - Intronic
1129950768 15:79589005-79589027 CAGAATCAACAGTTTCACAAAGG + Intergenic
1130784989 15:87086114-87086136 CAGAATTGCCAGATACACCAAGG - Intergenic
1131591045 15:93748392-93748414 CAGAATCAACAGATTCTCCAAGG + Intergenic
1133444703 16:5850063-5850085 CAGAGTAAACAGAATCACCTGGG - Intergenic
1134444159 16:14318204-14318226 CAGAATAAACAAATCCACAGGGG - Intergenic
1134864221 16:17590465-17590487 GAGAGAAAACAGAAGCACCAAGG + Intergenic
1135301616 16:21333467-21333489 CATAATTATCAGATTCACCAAGG - Intergenic
1137754234 16:50888761-50888783 GAGAATAAACAGATCCAGCCTGG + Intergenic
1137828284 16:51518471-51518493 CATAATCATCAGATTCACCAAGG + Intergenic
1137890807 16:52160248-52160270 CATAATCATCAGATTCACCAAGG - Intergenic
1138151715 16:54663350-54663372 CATAATCATCAGATTCACCAAGG + Intergenic
1138425727 16:56931162-56931184 CTGAAAAAACAGATGTCCCAAGG + Intergenic
1138843476 16:60537721-60537743 CACAGTCATCAGATGCACCAAGG - Intergenic
1141051084 16:80764564-80764586 AAGAATGAACAGACACACCATGG + Intronic
1143426959 17:6847639-6847661 CATAATCATCAGATTCACCAAGG - Intergenic
1143662361 17:8333740-8333762 CAGAAAAAACTGAGGCACAAAGG - Intergenic
1145324688 17:21794526-21794548 CAGTACAAACAGATCCACAAAGG + Intergenic
1146608024 17:34278725-34278747 CATAATCATCAGATTCACCAAGG + Intergenic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148322068 17:46763206-46763228 CAGAAAGAAGAGATGCAGCAGGG - Exonic
1149435856 17:56632553-56632575 CAGAATAATCACTTGAACCAGGG + Intergenic
1150190308 17:63231710-63231732 CATAATAATCAGATTCCCCAAGG - Intronic
1203182176 17_KI270729v1_random:69422-69444 GAGTATAAACAGATCCACAAAGG - Intergenic
1153509825 18:5839391-5839413 AAGAATAATGAGATGCTCCACGG + Intergenic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156541670 18:37918008-37918030 CAGAATGACCAGATGCACCATGG + Intergenic
1157025461 18:43837167-43837189 CATAATTATCAGATTCACCAAGG + Intergenic
1157406852 18:47428931-47428953 CCCAATATAAAGATGCACCAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157694932 18:49714933-49714955 CATAATAGTCAGATTCACCAAGG - Intergenic
1158297505 18:56015004-56015026 CATAATCATCAGATTCACCAAGG - Intergenic
1158857988 18:61563071-61563093 CATAATTATCAGATTCACCAAGG - Intergenic
1159395782 18:67854036-67854058 CAGCATAAACAGGTGAAACAGGG - Intergenic
1159529619 18:69639142-69639164 TAGGAAAAACAGATGAACCAAGG + Intronic
1159562373 18:70008953-70008975 CATAATCATCAGATTCACCAAGG + Intronic
1160366963 18:78334804-78334826 CACAATAATGAGAAGCACCACGG - Intergenic
1161587328 19:5112765-5112787 CAGAAGAGACAGATTCACCTTGG - Intronic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1163513501 19:17749300-17749322 AAGAACAAACAAAGGCACCAAGG - Intronic
1164093200 19:21979268-21979290 CAGAATCGTCAGATTCACCAAGG + Intronic
1164195255 19:22951211-22951233 CATAATAGTCAGATTCACCAAGG + Intergenic
1165254424 19:34566663-34566685 CATAATCATCAGATTCACCAAGG - Intergenic
1168170386 19:54584223-54584245 CATAATTATCAGATTCACCAAGG - Intronic
1202656140 1_KI270708v1_random:23980-24002 CAAAATCATCAGATTCACCAAGG + Intergenic
925380842 2:3424857-3424879 ATGTACAAACAGATGCACCAGGG - Intronic
926508762 2:13746852-13746874 CATAATCATCAGATTCACCAAGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
928484861 2:31719415-31719437 CATAATCAACAGATTCTCCAAGG + Intergenic
928754343 2:34506292-34506314 CATAATTATCAGATTCACCAAGG + Intergenic
929255960 2:39812142-39812164 CATAATCATCAGATTCACCAAGG - Intergenic
929257562 2:39829425-39829447 CATAATCATCAGATTCACCAAGG - Intergenic
929333350 2:40711377-40711399 CATAATCATCAGATTCACCAAGG - Intergenic
930269898 2:49243853-49243875 CATAATCATCAGATTCACCAAGG + Intergenic
930274972 2:49300163-49300185 CATAATTATCAGATTCACCAAGG + Intergenic
930359504 2:50359797-50359819 CATAATCATCAGATTCACCAAGG + Intronic
930437435 2:51363143-51363165 CATAATTATCAGATTCACCAAGG - Intergenic
930440065 2:51393181-51393203 CATAATCATCAGATTCACCAAGG + Intergenic
930476903 2:51893007-51893029 CATAATCATCAGATTCACCAAGG + Intergenic
931488941 2:62723922-62723944 CATAATAATCAGATTCCCCAAGG - Intronic
931566616 2:63621715-63621737 CATAATCATCAGATTCACCAAGG + Intronic
932914049 2:75835665-75835687 CATAATCATCAGATTCACCAAGG + Intergenic
934015609 2:87877978-87878000 CACAATCAACAGATTCTCCAAGG - Intergenic
934531758 2:95094424-95094446 CATAATTATCAGATTCACCAAGG + Intronic
935355697 2:102197505-102197527 CAGGATAAAAAGACTCACCATGG - Intronic
935399608 2:102645993-102646015 CATAATCATCAGATTCACCAAGG + Intronic
935566108 2:104609007-104609029 CATAATCATCAGATTCACCAAGG + Intergenic
936769363 2:115893528-115893550 CATAATCATCAGATTCACCAAGG - Intergenic
936862193 2:117031350-117031372 CATAATAATCAGATTCTCCAAGG + Intergenic
937143320 2:119620281-119620303 CATAATCATCAGATTCACCAAGG + Intronic
937599323 2:123711038-123711060 CAGAAGAAACACATGTACTATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938926831 2:136050996-136051018 TTGATTAAAAAGATGCACCAGGG - Intergenic
939055705 2:137361923-137361945 CATAATTATCAGATTCACCAAGG + Intronic
939116732 2:138069787-138069809 CATAATCATCAGATTCACCAAGG - Intergenic
939327513 2:140712663-140712685 CAGAATAAACTGATGCAAACTGG - Intronic
940054377 2:149498677-149498699 CATAATCACCAGATTCACCAAGG - Intergenic
940096252 2:149979203-149979225 CATAATCACCAGATTCACCAAGG + Intergenic
940114589 2:150193864-150193886 CATAATCATCAGATTCACCAAGG + Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940602771 2:155881898-155881920 CATAATCATCAGATTCACCAAGG + Intergenic
940758119 2:157706155-157706177 CATAATCATCAGATTCACCAAGG + Intergenic
940934416 2:159475007-159475029 CAGAATCGTCAGATTCACCAAGG - Intronic
941149083 2:161891246-161891268 CAAAATCATCAGATTCACCAAGG - Intronic
941845480 2:170127598-170127620 CATAATCATCAGATTCACCAAGG + Intergenic
942407393 2:175670006-175670028 CATAATCATCAGATTCACCAAGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943130137 2:183843567-183843589 CATAATCATCAGATTCACCAAGG + Intergenic
943368787 2:186989862-186989884 CATAATAGTCAGATTCACCAAGG + Intergenic
943509474 2:188806212-188806234 CCTAATAAACTGATGCACCTAGG + Intergenic
943523608 2:188988104-188988126 CAGGATGACCAGATGTACCAGGG - Exonic
943987405 2:194640467-194640489 CATAATTATCAGATTCACCAAGG + Intergenic
944169258 2:196757067-196757089 CATAATTATCAGATTCACCAAGG - Intronic
944275296 2:197830712-197830734 CATAATCATCAGATTCACCAAGG + Intronic
946387772 2:219395658-219395680 CAAGAGAAAGAGATGCACCAAGG - Intronic
946790049 2:223292060-223292082 CATAATCATCAGATTCACCAAGG - Intergenic
946913177 2:224486808-224486830 CATAATCATCAGATTCACCAAGG + Intronic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
1170076660 20:12427126-12427148 CATAATCATCAGATTCACCAAGG - Intergenic
1171001033 20:21415527-21415549 CATAATCATCAGATTCACCAAGG + Intergenic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1171443371 20:25185284-25185306 CATAATCATCAGATTCACCAAGG - Intergenic
1171573093 20:26272302-26272324 CAGAAGGGACAGATGCCCCAGGG - Intergenic
1171779079 20:29402402-29402424 CAGAACACACATAAGCACCATGG + Intergenic
1171853189 20:30322815-30322837 CAGGATAAAAAGATGCTTCAAGG + Intergenic
1172926711 20:38543791-38543813 CAGAATAACCAAAGGCCCCATGG - Intronic
1173750981 20:45476622-45476644 CATAATCATCAGATTCACCAAGG - Intronic
1174246108 20:49182002-49182024 CAGATTAAACAGATGCCAGATGG + Intronic
1174947098 20:54999690-54999712 TAAAATAAGCAGATGCCCCATGG - Intergenic
1175071552 20:56338148-56338170 CAAAATTATCAGATTCACCAAGG + Intergenic
1175353447 20:58343182-58343204 GAGAAGTAACAGCTGCACCAAGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175704404 20:61165510-61165532 GGGCAGAAACAGATGCACCAAGG - Intergenic
1175795563 20:61768507-61768529 CAGAAGAAAAACAGGCACCAGGG + Intronic
1176631441 21:9142428-9142450 CAAAATCATCAGATTCACCAAGG - Intergenic
1176641860 21:9312430-9312452 CAAAATCATCAGATTCACCAAGG + Intergenic
1176716424 21:10354129-10354151 CAGAATTATCAGATTCACCAAGG - Intergenic
1176940813 21:14922814-14922836 AAAAATAAAGAGATGCCCCATGG - Intergenic
1177042513 21:16131649-16131671 CATAATCATCAGATCCACCAAGG - Intergenic
1177122323 21:17153423-17153445 CATAATTGTCAGATGCACCAAGG + Intergenic
1177136552 21:17310329-17310351 CATAATCATCAGATTCACCAAGG + Intergenic
1177142575 21:17373744-17373766 CATAATCATCAGATTCACCAAGG + Intergenic
1177184008 21:17774197-17774219 CATAATTATCAGATTCACCAAGG - Intergenic
1177541164 21:22495175-22495197 CATAATCATCAGATTCACCAAGG + Intergenic
1177794061 21:25754645-25754667 CACAAGAAACAGATATACCACGG - Intronic
1177871734 21:26580941-26580963 GAGAATAGACTAATGCACCAGGG + Intergenic
1178393737 21:32221171-32221193 CATAATCAACAGATTCACCAAGG + Intergenic
1178877092 21:36421910-36421932 CAGACTATACAGACTCACCAAGG - Intergenic
1179413808 21:41181970-41181992 CAGAATTAACAGTGGCATCATGG + Intronic
1180350874 22:11801782-11801804 CAAAATCATCAGATTCACCAAGG + Intergenic
1180375149 22:12085179-12085201 CAAAATCATCAGATTCACCAAGG + Intergenic
1180387331 22:12190288-12190310 CAAAATCATCAGATTCACCAAGG - Intergenic
1180601912 22:17025816-17025838 CAGAATTGTCAGATTCACCAAGG + Intergenic
1181000471 22:19985703-19985725 CGGACTTCACAGATGCACCACGG + Intronic
1181995563 22:26878907-26878929 CTGAATAAGCAGATGCTCCCGGG + Intergenic
1182816983 22:33173049-33173071 CATAATCATCAGATTCACCAAGG + Intronic
1183339373 22:37271166-37271188 CAGAATAAAGATATCCATCATGG - Intergenic
1184882652 22:47320482-47320504 CATAAAAAACAAATGCACCTAGG - Intergenic
949450181 3:4176228-4176250 CATAATCATCAGATTCACCAAGG + Intronic
949453487 3:4213102-4213124 CATAATCATCAGATTCACCAAGG + Intronic
949846274 3:8373574-8373596 CATAATCATCAGATTCACCAAGG + Intergenic
950225096 3:11226961-11226983 CAGGATATACAGAAGCACCCTGG - Intronic
950561808 3:13734850-13734872 CACAATCATCAGATTCACCAAGG - Intergenic
951237542 3:20253132-20253154 CATAATCATCAGATTCACCAAGG - Intergenic
951254318 3:20431567-20431589 CATAATCATCAGATTCACCAAGG - Intergenic
951692913 3:25416067-25416089 CTGAAGAAAAAGATGCAACAAGG + Intronic
951777089 3:26322516-26322538 CATAATCATCAGATTCACCAAGG - Intergenic
952737526 3:36705218-36705240 GAAAATAAACAGAAGCACCATGG - Intergenic
952842423 3:37659128-37659150 CATAATCATCAGATTCACCAAGG - Intronic
952929014 3:38345569-38345591 CAGAAGAATCAGTTGAACCAGGG + Intergenic
953047406 3:39306219-39306241 CACAATCATCAGATTCACCAGGG + Intergenic
953074234 3:39552893-39552915 CATAATCATCAGATTCACCAAGG + Intergenic
953210951 3:40874761-40874783 CATAAGAAAAAGATGAACCAAGG + Intergenic
953215765 3:40916458-40916480 CAGAATACACAGTTGCTCCTGGG - Intergenic
953254833 3:41279500-41279522 CATAATTGTCAGATGCACCAAGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954826857 3:53381113-53381135 CAGGATACACAGATTCTCCAAGG + Intergenic
955119089 3:56037743-56037765 CAGAATCATCAGATTCTCCAAGG + Intronic
955414115 3:58677051-58677073 CATAATCATCAGATTCACCAAGG - Intergenic
956032613 3:65055406-65055428 CATAATTATCAGATTCACCAAGG + Intergenic
956157164 3:66310943-66310965 CATAATCATCAGATTCACCAAGG - Intronic
956300181 3:67763953-67763975 CATAATCATCAGATTCACCAAGG - Intergenic
956382882 3:68684879-68684901 CATAATCATCAGATTCACCAAGG - Intergenic
957011097 3:75007334-75007356 CATAATCATCAGATTCACCAAGG - Intergenic
957086066 3:75678266-75678288 CAGAACACACATATGCACCATGG - Intergenic
957731192 3:84139230-84139252 CATAATAAACACATACATCAAGG + Intergenic
957794345 3:84984164-84984186 CAAAATAAGGAGATGCAACATGG - Intronic
957811446 3:85228075-85228097 CATAATCATCAGATTCACCAAGG - Intronic
957993076 3:87652318-87652340 CATAATCACCAGATTCACCAAGG - Intergenic
958178377 3:90025204-90025226 CAGAATAAATAAATACAACATGG - Intergenic
958520757 3:95183204-95183226 CATAATCATCAGATTCACCAAGG - Intergenic
958522075 3:95203255-95203277 CAGAATCATCAGATTCTCCAAGG - Intergenic
959428507 3:106222836-106222858 CATAATCATCAGATTCACCAAGG - Intergenic
959815981 3:110673251-110673273 CATCATCATCAGATGCACCAAGG + Intergenic
960018150 3:112916663-112916685 CATAATCATCAGATTCACCAAGG + Intergenic
960276596 3:115736607-115736629 CATAATTATCAGATTCACCAAGG - Intergenic
960444935 3:117736393-117736415 GCGAATCAACGGATGCACCAAGG - Intergenic
960654076 3:119982897-119982919 CATAATTGACAGATTCACCAAGG + Intronic
960759928 3:121062452-121062474 CATAATCATCAGATTCACCAAGG - Intronic
961233920 3:125346984-125347006 TAGAATAAACAAGTTCACCAAGG + Intronic
961371057 3:126431954-126431976 AATAAGAAACAGATGCACAAGGG - Intronic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
962291604 3:134141557-134141579 CATAATTGTCAGATGCACCAAGG + Intronic
962510491 3:136095010-136095032 CAGAATCTGCAGATGCCCCAAGG + Intronic
962639966 3:137375750-137375772 CATAATCATCAGATTCACCAAGG - Intergenic
963898853 3:150713841-150713863 CATAATCATCAGATTCACCAAGG + Intergenic
963980419 3:151530404-151530426 CATAATCATCAGATTCACCAAGG + Intergenic
964270179 3:154946846-154946868 CATAATTTTCAGATGCACCAAGG + Intergenic
964713048 3:159692175-159692197 CATAATCATCAGATTCACCAAGG - Intronic
965090906 3:164161878-164161900 CATAATCATCAGATTCACCAAGG - Intergenic
965288633 3:166848408-166848430 CATAATAATCAGATTCTCCAAGG - Intergenic
966493895 3:180558010-180558032 CATAATCATCAGATTCACCAAGG + Intergenic
967419400 3:189257456-189257478 CATAATCATCAGATTCACCAAGG - Intronic
967823675 3:193861724-193861746 CCGAGTAAAGTGATGCACCAGGG + Intergenic
967860532 3:194148046-194148068 CAGAAGAAAGAGATGCTTCAGGG - Intergenic
1202745033 3_GL000221v1_random:92588-92610 CAAAATCATCAGATTCACCAAGG - Intergenic
968477137 4:817114-817136 CACATTAAACAGATGCATTAAGG + Intronic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
968828920 4:2921587-2921609 CATAATCATCAGATTCACCAAGG - Intronic
969271260 4:6104937-6104959 CAGAATCCACAAATGCCCCAAGG + Intronic
969636498 4:8372463-8372485 CAGAGTATGCAGGTGCACCAAGG - Intronic
970124125 4:12790225-12790247 TAGAATAAAAAGATGAACAAAGG - Intergenic
970470306 4:16371720-16371742 CATAATAGTCAGATTCACCAAGG - Intergenic
970727346 4:19061842-19061864 CATAATCACCAGATTCACCAAGG + Intergenic
970917620 4:21353838-21353860 CACAATTATCAGATTCACCAAGG + Intronic
971423680 4:26495919-26495941 CAGAAGAATCACTTGCACCAGGG + Intergenic
971698052 4:29931520-29931542 CAGAATTATCAGATTCACCAAGG + Intergenic
972210317 4:36828895-36828917 CAGAGTAAACAGATAACCCATGG + Intergenic
972261211 4:37409696-37409718 CATAATCATCAGATTCACCAAGG + Intronic
972500477 4:39673474-39673496 CATAATCATCAGATTCACCAAGG - Intergenic
972742807 4:41905062-41905084 CATAATCATCAGATTCACCAAGG - Intergenic
972755740 4:42043759-42043781 CATAATCATCAGATTCACCAAGG + Intronic
972847433 4:43006474-43006496 CATAAGAGACAGATGCACCTGGG - Intronic
973273180 4:48281610-48281632 CATAATCATCAGATTCACCAAGG + Intergenic
973739710 4:53907993-53908015 CAGGATAATCAGTTGCACCTGGG - Intronic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
974391496 4:61275827-61275849 GAGAATAAATAGATTCAACAGGG - Intronic
974720042 4:65726351-65726373 CATAATTATCAGATTCACCAAGG + Intergenic
974899560 4:67980795-67980817 CACAATCATCAGATTCACCAAGG - Intergenic
975203417 4:71617493-71617515 CATAATTATCAGATGTACCAAGG + Intergenic
975638966 4:76479671-76479693 CATAATCATCAGATTCACCAAGG + Intronic
976065725 4:81185168-81185190 CATAATCATCAGATTCACCAAGG + Intronic
976363217 4:84204306-84204328 CAAAATCATCAGATTCACCAAGG + Intergenic
976388459 4:84485004-84485026 CATAATAATCAGATGTACAAGGG + Intergenic
976493766 4:85702019-85702041 CAGAAGAAAAATATGTACCATGG - Intronic
976872297 4:89810083-89810105 CAAAATAAACACATGCACTATGG + Intronic
977629948 4:99231569-99231591 CACAATCATCAGATTCACCAAGG - Intergenic
977793566 4:101135370-101135392 CAGAATAAACTGTTGCACTAAGG - Intronic
977888053 4:102274642-102274664 CATAATCATCAGATTCACCAAGG + Intronic
978055081 4:104253635-104253657 CATAATCATCAGATTCACCAAGG + Intergenic
978090465 4:104708547-104708569 CATAATCATCAGATTCACCAAGG + Intergenic
978108456 4:104932252-104932274 CACAATCATCAGATTCACCAAGG + Intergenic
978179362 4:105774802-105774824 CATAATCATCAGATTCACCAAGG - Intronic
979012494 4:115388936-115388958 CATAATCATCAGATTCACCAAGG + Intergenic
979554802 4:122033119-122033141 CATAATCATCAGATTCACCAAGG - Intergenic
979705454 4:123714729-123714751 CAGAATTGTCAGATTCACCAAGG + Intergenic
980171114 4:129291385-129291407 CACAATCATCAGATTCACCAAGG - Intergenic
980513318 4:133822184-133822206 CATAATCATCAGATTCACCAAGG - Intergenic
980694641 4:136338915-136338937 CATAATAATCAGATTCTCCAAGG + Intergenic
981296850 4:143142054-143142076 CATAATCATCAGATTCACCAAGG + Intergenic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
981662684 4:147185559-147185581 CATAATCATCAGATTCACCAAGG + Intergenic
981750033 4:148084208-148084230 CAGAATAGTCAGATTCGCCAAGG + Intronic
982298779 4:153858177-153858199 CATAATCATCAGATTCACCAAGG - Intergenic
982324057 4:154110472-154110494 CATAATCATCAGATTCACCAAGG + Intergenic
982883416 4:160748057-160748079 CATAATTATCAGATTCACCAAGG + Intergenic
983331205 4:166332168-166332190 CAAAATCATCAGATTCACCAAGG - Intergenic
983602554 4:169547424-169547446 CATAATTGTCAGATGCACCAAGG - Intronic
983793871 4:171834823-171834845 CAGAGAAAACTGATGAACCAGGG + Intronic
984008899 4:174347057-174347079 CATAATCATCAGATTCACCAAGG - Intergenic
984032369 4:174619819-174619841 CATAATCATCAGATTCACCAAGG + Intergenic
984899292 4:184570429-184570451 CAGAAGTGACAGATGCCCCAGGG - Intergenic
985026263 4:185742278-185742300 CTAAATAAACATATGCACCCAGG + Intronic
985204651 4:187522173-187522195 CATAATCATCAGATTCACCAAGG + Intergenic
985443954 4:190009273-190009295 CAGAACACACATATGCACCATGG + Intergenic
1202756742 4_GL000008v2_random:70626-70648 CAAAATCATCAGATTCACCAAGG + Intergenic
986005832 5:3668384-3668406 CACAATCATCAGATTCACCAAGG - Intergenic
986110535 5:4711332-4711354 CATAATCATCAGATTCACCAAGG + Intergenic
986277733 5:6294260-6294282 CAGAGTAAACAGATGACCTATGG - Intergenic
986675357 5:10179340-10179362 CATAATCATCAGATTCACCAAGG + Intergenic
987019432 5:13854063-13854085 CATAATCATCAGATTCACCAAGG + Intronic
987399660 5:17462454-17462476 CATAATCATCAGATTCACCAAGG - Intergenic
987873094 5:23645973-23645995 CATAATTGTCAGATGCACCAAGG + Intergenic
987923911 5:24316418-24316440 CATAATCATCAGATTCACCAAGG - Intergenic
988560654 5:32278145-32278167 CATAACAAAGAGAGGCACCATGG + Intronic
988719381 5:33860704-33860726 CATAATTATCAGATTCACCAAGG + Intronic
988752096 5:34198147-34198169 CAGAAGAAACAGTTGAACCCAGG + Intergenic
988770974 5:34433208-34433230 CATAATCATCAGATTCACCAAGG - Intergenic
989046658 5:37280428-37280450 CAGAATAGACAAAACCACCATGG - Intergenic
989086630 5:37683792-37683814 CATAATAATCAGATTCTCCAAGG - Intronic
989194338 5:38701326-38701348 CATAATCATCAGATTCACCAAGG + Intergenic
989516960 5:42354859-42354881 CATAATCATCAGATTCACCAAGG + Intergenic
989522314 5:42416865-42416887 CATAATCATCAGATTCACCAAGG - Intergenic
989825497 5:45849460-45849482 CATAATTATCAGATTCACCAAGG + Intergenic
990195406 5:53309610-53309632 CATAATCATCAGATTCACCAAGG - Intergenic
990223651 5:53624690-53624712 GATAATAAACAAATTCACCAAGG - Intronic
990351348 5:54919657-54919679 CATAATCATCAGATTCACCAAGG + Intergenic
990414623 5:55574422-55574444 CAAAATAAATAAATGCACAAAGG + Intergenic
990837985 5:60043486-60043508 CATAATCATCAGATTCACCAAGG + Intronic
991046603 5:62229722-62229744 CATAATCATCAGATTCACCAAGG - Intergenic
991128309 5:63091997-63092019 CATAATCATCAGATTCACCAAGG + Intergenic
991150264 5:63359805-63359827 CATAATCATCAGATTCACCAAGG - Intergenic
991158300 5:63464398-63464420 CAGAGTAAACAGATAACCCACGG + Intergenic
991243296 5:64483440-64483462 CATAATTATCAGATTCACCAAGG - Intergenic
991397593 5:66221349-66221371 CATAATCATCAGATTCACCAAGG - Intergenic
991442559 5:66666220-66666242 CAGAATAAAAATATGAGCCAAGG - Intronic
992227717 5:74635207-74635229 CACAATCAACAAATGGACCATGG - Exonic
992316799 5:75564832-75564854 CATAATCATCAGATTCACCAAGG - Intronic
992516849 5:77502560-77502582 CATAATTATCAGATTCACCAAGG + Intronic
992756629 5:79912660-79912682 CATAATCATCAGATTCACCAAGG + Intergenic
993080853 5:83298560-83298582 GTGAATAAACAGATATACCAGGG - Intronic
993381687 5:87216343-87216365 CATAATCATCAGATTCACCAAGG - Intergenic
993895152 5:93524547-93524569 CACAATCATCAGATTCACCAAGG + Intergenic
993947843 5:94136901-94136923 CATAATCATCAGATTCACCAAGG - Intergenic
994437900 5:99762319-99762341 CATAATCATCAGATTCACCAAGG - Intergenic
994521144 5:100837530-100837552 CAGAATAAACATATGGTTCAAGG - Intronic
994621963 5:102174475-102174497 CAGAAGAAAGAGAGACACCAGGG - Intergenic
995093749 5:108211778-108211800 CATAATCATCAGATTCACCAAGG - Intronic
995108377 5:108400460-108400482 CATAATCACCAGATTCACCAAGG + Intergenic
995112023 5:108438870-108438892 CATAATCATCAGATTCACCAAGG + Intergenic
995211053 5:109539676-109539698 CATAATCATCAGATTCACCAAGG + Intergenic
995316512 5:110780782-110780804 CATAATCATCAGATTCACCAAGG + Intergenic
995815898 5:116167535-116167557 CATAATCATCAGATTCACCAAGG + Intronic
996055216 5:118974975-118974997 CATAATCATCAGATTCACCAAGG - Intronic
996270960 5:121603843-121603865 CAAAATCATCAGATTCACCAAGG + Intergenic
996490907 5:124094949-124094971 CAGAATAAACAGACAACCCACGG - Intergenic
996675869 5:126173621-126173643 CACAATCAACAGATTCTCCAAGG + Intergenic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997902931 5:137784629-137784651 CATAATCATCAGATTCACCAAGG + Intergenic
998537894 5:142951461-142951483 AATAATACACAGAGGCACCAGGG - Intronic
998717895 5:144906772-144906794 CATAATCATCAGATTCACCAAGG + Intergenic
999897660 5:156052493-156052515 CAGAATAAACTGTTGGGCCAGGG + Intronic
999937220 5:156500703-156500725 CTGAATAAACATATGCACTCTGG + Intronic
1000033756 5:157426005-157426027 CATAATCATCAGATTCACCAAGG + Intronic
1000798195 5:165691856-165691878 CATAATCATCAGATTCACCAAGG - Intergenic
1000820023 5:165972107-165972129 CATAATCATCAGATTCACCAAGG - Intergenic
1000876799 5:166649583-166649605 CAGAAGAATCAGTTGAACCAGGG + Intergenic
1002673715 5:180891390-180891412 CACAATATTCAGATTCACCAAGG + Intergenic
1002996291 6:2288220-2288242 CATAATCATCAGATTCACCAAGG + Intergenic
1003165721 6:3676658-3676680 CATAATTATCAGATTCACCAAGG - Intergenic
1003556132 6:7141628-7141650 CAGAATAAAAACATGTAGCAGGG + Intronic
1003710693 6:8586196-8586218 CATAATCATCAGATTCACCAAGG + Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1003862992 6:10338767-10338789 GAGAATACCCAGATGCATCACGG - Intergenic
1005147388 6:22707085-22707107 CAGATCAAATAGATGCACCTAGG + Intergenic
1005208355 6:23431212-23431234 CATAATTATCAGATTCACCAAGG - Intergenic
1006639623 6:35483289-35483311 CAGACTTGACATATGCACCATGG + Intronic
1007018225 6:38490990-38491012 CAGAATAAAAAGATCCAAAAGGG + Intronic
1007858317 6:44880618-44880640 CATAATCATCAGATTCACCAAGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008782567 6:55125564-55125586 CAGAATCATCATATTCACCAAGG - Intronic
1008785280 6:55160028-55160050 CATAATTGTCAGATGCACCAAGG + Intronic
1009679551 6:66874217-66874239 CATAATTGTCAGATGCACCAAGG - Intergenic
1009794893 6:68454770-68454792 CATAATCATCAGATTCACCAAGG - Intergenic
1009900198 6:69800360-69800382 CAGAAAAAACGGAGGCCCCAGGG - Intergenic
1010459629 6:76099236-76099258 CATAATCATCAGATTCACCAAGG + Intergenic
1010594758 6:77749809-77749831 CATAATGATCAGATTCACCAAGG + Intronic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1010954272 6:82072260-82072282 AAAAATAAACAGCAGCACCAGGG + Intergenic
1011062844 6:83291571-83291593 CATAATTATCAGATTCACCAAGG - Intronic
1011174277 6:84542509-84542531 CATAATCATCAGATTCACCAAGG + Intergenic
1011199683 6:84822017-84822039 CATAATCATCAGATGCACCAAGG - Intergenic
1011298123 6:85845881-85845903 CATAATCATCAGATTCACCAAGG - Intergenic
1011298776 6:85852328-85852350 CATAATTATCAGATTCACCAAGG - Intergenic
1011318538 6:86064244-86064266 CATAATCACCAGATTCACCAAGG - Intergenic
1011831907 6:91384392-91384414 TATAATAAAGAAATGCACCAGGG - Intergenic
1012598144 6:101063685-101063707 CATAATTATCAGATTCACCAAGG + Intergenic
1012621724 6:101352922-101352944 TAGTATAAAAAAATGCACCAGGG - Intergenic
1012933394 6:105340082-105340104 CATAATTATCAGATTCACCAAGG + Intronic
1013038170 6:106406577-106406599 CATAATCATCAGATTCACCAAGG + Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013453170 6:110304847-110304869 CATAATCATCAGATTCACCAAGG + Intronic
1014113548 6:117647270-117647292 CAGAATCATCAGATTCACCAAGG + Intergenic
1014352486 6:120362232-120362254 CAGAATCGTCAGATTCACCAAGG - Intergenic
1014432804 6:121389900-121389922 CAAAATAAACACCTCCACCATGG - Intergenic
1014560460 6:122883761-122883783 CATAATCATCAGATTCACCAAGG - Intergenic
1014675767 6:124363352-124363374 CAGAAACAACAAATGCACCCAGG - Intronic
1014753865 6:125281890-125281912 CATAATCAGCAGATTCACCAAGG + Intronic
1014836390 6:126165733-126165755 CATAATCATCAGATTCACCAAGG - Intergenic
1015291260 6:131540249-131540271 CATAATCATCAGATTCACCAAGG + Intergenic
1015358365 6:132306552-132306574 CATAATAATCAGATTCTCCAAGG + Intronic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1015585975 6:134776925-134776947 CATAATCATCAGATTCACCAAGG + Intergenic
1015623211 6:135154787-135154809 CATAATCATCAGATTCACCAAGG - Intergenic
1015704777 6:136076173-136076195 CAAAATAAACTGATGCAGCCGGG + Intronic
1015745117 6:136501745-136501767 GAGAATAGACAGATCCACCATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018257539 6:161936876-161936898 CAGGATAATCAGTTGCACCCGGG - Intronic
1020367065 7:7392425-7392447 CATAATAGTCAGATTCACCAAGG - Intronic
1020690762 7:11352068-11352090 CATAATCATCAGATTCACCAAGG - Intergenic
1020753237 7:12169312-12169334 CATAATCATCAGATTCACCAAGG - Intergenic
1020874092 7:13672469-13672491 CATAATCATCAGATTCACCAAGG - Intergenic
1021022609 7:15622514-15622536 TAAAATAAACATATACACCAAGG - Intronic
1021224397 7:18011386-18011408 CATAATCATCAGATTCACCAAGG - Intergenic
1021322486 7:19228554-19228576 CATAATCATCAGATTCACCAAGG + Intergenic
1022058661 7:26768907-26768929 CATAATCATCAGATTCACCAAGG - Intronic
1023065904 7:36377552-36377574 CATAATCATCAGATTCACCAAGG - Intronic
1023497229 7:40810706-40810728 CAGAATAAACAGATGACCTATGG - Intronic
1023525613 7:41099516-41099538 CAGAATTCACAGATACAACAGGG + Intergenic
1023651047 7:42369873-42369895 CATAATTATCAGATTCACCAAGG - Intergenic
1023697586 7:42863877-42863899 CATAATCATCAGATTCACCAAGG - Intergenic
1024164085 7:46712804-46712826 CACATGAGACAGATGCACCAAGG - Intronic
1024372739 7:48605663-48605685 CATAATCATCAGATTCACCAAGG - Intronic
1024385095 7:48741893-48741915 CAGAATCAGCAGATGCCCTAGGG + Intergenic
1024817341 7:53286775-53286797 CATAATTATCAGATGCACCAAGG - Intergenic
1025286278 7:57664585-57664607 CAGAAGGGACAGATGCCCCAGGG + Intergenic
1027576074 7:79932847-79932869 CATAATAATCAGATTCTCCAAGG - Intergenic
1027637264 7:80690694-80690716 CATAATCATCAGATTCACCAAGG + Intergenic
1027786382 7:82584085-82584107 CATAATCATCAGATTCACCAAGG - Intergenic
1027790571 7:82635075-82635097 CATAATCATCAGATTCACCAAGG + Intergenic
1027792520 7:82651529-82651551 CATAATTATCAGATTCACCAAGG + Intergenic
1028144479 7:87306045-87306067 CATAATCATCAGATTCACCAAGG + Intergenic
1028675190 7:93451802-93451824 CAGAAGATACATATACACCATGG + Intronic
1028786136 7:94796065-94796087 CATAATCAACATATTCACCAAGG + Intergenic
1028788198 7:94820773-94820795 CATAATCATCAGATTCACCAAGG - Intergenic
1028945361 7:96573717-96573739 CATAATCATCAGATTCACCAAGG - Intronic
1029313755 7:99692346-99692368 CATAATTATCAGATTCACCAAGG - Intronic
1029340463 7:99939653-99939675 CAGAATAATCTGATGATCCAAGG + Intergenic
1029845073 7:103404632-103404654 CATAATCATCAGATTCACCAAGG - Intronic
1029850403 7:103455971-103455993 CATAATCATCAGATTCACCAAGG - Intergenic
1030159719 7:106494580-106494602 CAGAATCATCAGATTCACCAAGG + Intergenic
1030403751 7:109084909-109084931 CATAATCACCAGATTCACCAAGG + Intergenic
1030421428 7:109310968-109310990 AAGAATAAACAAATCCCCCAAGG + Intergenic
1030770941 7:113474378-113474400 CAGAATCATCAGATTCACCAAGG - Intergenic
1030936857 7:115595277-115595299 CATAATCATCAGATTCACCAAGG + Intergenic
1031031973 7:116744730-116744752 CATAATAGTCAGATTCACCAAGG + Intronic
1031803522 7:126278483-126278505 CATAATTATCAGATTCACCAAGG - Intergenic
1032029206 7:128468389-128468411 CAGCATAAACAGAGACCCCAAGG - Intergenic
1033680210 7:143586083-143586105 CAGAATTGTCAGATTCACCAAGG + Intergenic
1033691628 7:143743359-143743381 CAGAATTGTCAGATTCACCAAGG - Intergenic
1036204173 8:6793340-6793362 GAAAATAAAAAGATGCACCCTGG + Intergenic
1036927056 8:12917219-12917241 CAGAATAAACTGATTCATGAAGG + Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1038083131 8:24162984-24163006 CATAATCATCAGATTCACCAAGG - Intergenic
1038366316 8:26939389-26939411 CATAATTGTCAGATGCACCAAGG - Intergenic
1038594424 8:28873974-28873996 CAGAATCCACAAATACACCAGGG - Intronic
1039435718 8:37557871-37557893 AAGAAGAAACGGAGGCACCAGGG - Intergenic
1039671910 8:39611180-39611202 CAGAAAAAACAGAGGCCACATGG - Intronic
1039754669 8:40510879-40510901 CATAATCATCAGATTCACCAAGG - Intergenic
1039766847 8:40637630-40637652 CAGAATAGAAAGAGGCACTAAGG + Intronic
1041050988 8:53933798-53933820 CATAATCATCAGATTCACCAAGG + Intronic
1041383009 8:57272025-57272047 CATAATCATCAGATTCACCAAGG - Intergenic
1041836801 8:62225116-62225138 CATAATCATCAGATTCACCAAGG + Intergenic
1042070644 8:64929882-64929904 CATAATCATCAGATTCACCAAGG - Intergenic
1042478984 8:69281878-69281900 CATAATCATCAGATTCACCAAGG + Intergenic
1042812734 8:72844389-72844411 CATAATCATCAGATTCACCAAGG - Intronic
1042946358 8:74158199-74158221 CATAATCATCAGATTCACCAAGG + Intergenic
1042969139 8:74389626-74389648 CATAATCATCAGATTCACCAAGG - Intronic
1043244272 8:77978187-77978209 CATAATTATCAGATTCACCAAGG - Intergenic
1043532608 8:81167354-81167376 CATAATCATCAGATTCACCAAGG + Intergenic
1043647072 8:82534803-82534825 CATAATCATCAGATTCACCAAGG - Intergenic
1043748738 8:83908927-83908949 CATAATCATCAGATTCACCAAGG - Intergenic
1044117038 8:88348684-88348706 CATAATCATCAGATGCTCCAAGG - Intergenic
1044267906 8:90204845-90204867 CATAATCATCAGATTCACCAAGG + Intergenic
1044595044 8:93951415-93951437 CATAATCATCAGATTCACCAAGG - Intergenic
1044677157 8:94740921-94740943 CATAACAACCAGATGCACTATGG - Intronic
1045647174 8:104310252-104310274 CATAATTATCAGATTCACCAAGG + Intergenic
1046106675 8:109674221-109674243 CATAATCATCAGATTCACCAAGG + Intronic
1046277976 8:111987269-111987291 CATAATCATCAGATTCACCAAGG + Intergenic
1046416164 8:113916403-113916425 CATAATAATCAGATTCTCCAAGG - Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1046947302 8:119986478-119986500 CATAATCATCAGATTCACCAAGG - Intronic
1047604287 8:126458934-126458956 CATAATAGTCAGATTCACCAAGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050129984 9:2402156-2402178 CATAATTAACAGATTCACAAAGG - Intergenic
1050239731 9:3622783-3622805 CATAATCATCAGATTCACCAAGG - Intergenic
1050300313 9:4252056-4252078 CATAATTATCAGATTCACCAAGG - Intronic
1050678535 9:8083908-8083930 CATAATTGGCAGATGCACCAAGG - Intergenic
1050817827 9:9837745-9837767 AAGAATAAAAAAATGCAGCAAGG - Intronic
1051354094 9:16225017-16225039 CATAATCATCAGATTCACCAAGG + Intronic
1051447230 9:17153605-17153627 CATAATCATCAGATTCACCAAGG - Intronic
1051670291 9:19503558-19503580 CATAATCATCAGATTCACCAAGG - Intergenic
1052130802 9:24844302-24844324 GAGAATAAACAGAAACACTATGG - Intergenic
1052134252 9:24890454-24890476 CATAATCATCAGATTCACCAAGG + Intergenic
1052281045 9:26734018-26734040 CATAATCATCAGATTCACCAAGG - Intergenic
1052403156 9:28026149-28026171 CAGAATAAACAGAAGTTCCTGGG - Intronic
1052752921 9:32510279-32510301 CATAATCATCAGATTCACCAAGG + Intronic
1053020884 9:34693179-34693201 CAGAATAACCAGAACCATCATGG - Intergenic
1053366905 9:37529241-37529263 CAGTGTAACCAGATCCACCATGG - Exonic
1056176606 9:84042527-84042549 CATAATCATCAGATTCACCAAGG - Intergenic
1056997590 9:91478100-91478122 CATAATCATCAGATTCACCAAGG - Intergenic
1057362074 9:94382505-94382527 GAGAATGAAAAGATGGACCACGG - Intronic
1057661281 9:97005658-97005680 GAGAATGAAAAGATGGACCACGG + Intronic
1057697835 9:97339609-97339631 CACAATTGTCAGATGCACCAAGG - Intronic
1057846171 9:98526377-98526399 CAGAGAGAACAGATGCACAAAGG - Intronic
1058034409 9:100235818-100235840 CATAATCATCAGATTCACCAAGG - Intronic
1058182693 9:101817200-101817222 CATAATCATCAGATTCACCACGG + Intergenic
1058408638 9:104705147-104705169 CATAATCATCAGATTCACCAAGG + Intergenic
1058498266 9:105583736-105583758 CATAAAAAACAGATGCCCTAAGG - Intronic
1058597966 9:106636162-106636184 CAGAATATACATATATACCATGG - Intergenic
1059513538 9:114871370-114871392 CATAATCATCAGATTCACCAAGG + Intergenic
1060066630 9:120507652-120507674 CAAATAAAACAGATGCACCCGGG - Intronic
1060353423 9:122880412-122880434 CAAAATAAAGGGATGCAACAGGG - Intronic
1060544381 9:124451673-124451695 CAGAGGAAACAGTAGCACCACGG - Intronic
1060857016 9:126922576-126922598 AAAAATAAACAGATGCACAGAGG - Intronic
1060874101 9:127067713-127067735 ATGAATAAACAGAAGCCCCAGGG - Intronic
1062652777 9:137586842-137586864 CAAAATACACAGAAGCATCAGGG + Intronic
1062678229 9:137761010-137761032 AAAAATAAAAAGATGCACTAAGG + Intronic
1203537536 Un_KI270743v1:55482-55504 CAAAATCATCAGATTCACCAAGG + Intergenic
1186315409 X:8364618-8364640 CAGAATAAGCAAATGCATGAAGG - Intergenic
1186752928 X:12640428-12640450 CATAATTCACAGAGGCACCAGGG + Intronic
1186773137 X:12837804-12837826 CATAATCATCAGATTCACCAAGG - Intergenic
1186960773 X:14734674-14734696 CATAATCATCAGATTCACCAAGG - Intergenic
1187853873 X:23617965-23617987 CAGAAAGAACATATGCACCTGGG + Intergenic
1188084313 X:25884024-25884046 CATAATCATCAGATTCACCAAGG + Intergenic
1188561064 X:31469621-31469643 CATAATAATCGGATTCACCAAGG - Intronic
1188862920 X:35278771-35278793 CAGAAGAAACGGATGCTCCTAGG + Intergenic
1189039592 X:37528904-37528926 CATAATCATCAGATTCACCAAGG - Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190341278 X:49298463-49298485 CATAATCATCAGATTCACCAAGG - Intronic
1190979670 X:55444911-55444933 CATAATGGACAGATTCACCAAGG + Intergenic
1191039340 X:56062635-56062657 AAGAATCATCAGATTCACCAAGG - Intergenic
1191081024 X:56509621-56509643 CATAATCAACAGATTCACCAAGG + Intergenic
1191119890 X:56892315-56892337 CATAATAATCAGGTTCACCAAGG + Intergenic
1191159557 X:57313429-57313451 CATAGTAATCAGATTCACCAAGG + Intronic
1191181699 X:57570821-57570843 CATAATCATCAGATTCACCAAGG + Intergenic
1191185375 X:57606195-57606217 CAAAATAATCAGATTCTCCAAGG - Intergenic
1191208273 X:57856678-57856700 CAGAATCGTCAGATTCACCAAGG + Intergenic
1191627262 X:63282812-63282834 GAGAAAAAACAGAAGCACCAAGG + Intergenic
1191705280 X:64087307-64087329 CATAATCATCAGATTCACCAAGG + Intergenic
1191725615 X:64277684-64277706 CATAATCATCAGATTCACCAAGG - Intronic
1191848345 X:65567253-65567275 CATAATCATCAGATTCACCAAGG - Intergenic
1191974712 X:66859437-66859459 CATAATCATCAGATTCACCAAGG + Intergenic
1192729608 X:73790020-73790042 CATAATCATCAGATTCACCAAGG - Intergenic
1192878957 X:75261974-75261996 CATAATATTCAGATTCACCAAGG + Intergenic
1192960802 X:76128534-76128556 CATAATAATCAGATTCTCCAAGG + Intergenic
1192999306 X:76547065-76547087 CATAATCATCAGATTCACCAAGG - Intergenic
1193245112 X:79219002-79219024 CATAATCATCAGATTCACCAAGG - Intergenic
1193394359 X:80966946-80966968 CATAATATTCAGATTCACCAAGG - Intergenic
1193409499 X:81145188-81145210 CATAATCATCAGATTCACCAAGG + Intronic
1193419751 X:81269668-81269690 CATAATCATCAGATTCACCAAGG - Intronic
1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG + Intergenic
1193580927 X:83261598-83261620 CATAATAATCAGATTCTCCAAGG + Intergenic
1193615840 X:83687369-83687391 CATAATCATCAGATTCACCAAGG - Intergenic
1193949506 X:87780105-87780127 CATAATCATCAGATTCACCAAGG + Intergenic
1194098746 X:89675808-89675830 CATAATCATCAGATTCACCAAGG + Intergenic
1195270336 X:103222398-103222420 CAGAATCATCAGATTCTCCAAGG + Intergenic
1195414399 X:104603996-104604018 CATAATCATCAGATTCACCAAGG + Intronic
1195414878 X:104609304-104609326 CATAATCATCAGATTCACCAAGG - Intronic
1195580112 X:106492277-106492299 CATAATCATCAGATTCACCAAGG - Intergenic
1195832700 X:109077241-109077263 CATAATCATCAGATTCACCAAGG - Intergenic
1195882326 X:109605082-109605104 CACAATCATCAGATTCACCAAGG + Intergenic
1195948368 X:110239743-110239765 CATAATCATCAGATCCACCAAGG + Intronic
1195985753 X:110628008-110628030 CATAATCATCAGATTCACCAAGG + Intergenic
1196159174 X:112463514-112463536 CATAATAGTCAGATTCACCAAGG + Intergenic
1197098159 X:122620294-122620316 CATAATCATCAGATTCACCAAGG - Intergenic
1197157408 X:123284941-123284963 CATAATCATCAGATTCACCAAGG + Intronic
1197614132 X:128673462-128673484 CATAATCGACAGATCCACCAAGG - Intergenic
1198085812 X:133280629-133280651 CATAATAATCAGATTCACCAAGG + Intergenic
1198490115 X:137131128-137131150 CATAATCGACAGATTCACCAAGG + Intergenic
1198669550 X:139064624-139064646 CATAATCATCAGATTCACCAAGG - Intronic
1199094929 X:143726853-143726875 CATAATCAACAGATTCACCAAGG + Intergenic
1199116193 X:143996033-143996055 CAGAATAAACAGATAACCTATGG + Intergenic
1199128874 X:144160549-144160571 CACAATCAACAGATTCTCCAAGG + Intergenic
1199365868 X:146981903-146981925 CATAATCAACAGATTCTCCAAGG - Intergenic
1199376068 X:147110635-147110657 CAGAATCATCAGATTCTCCAAGG + Intergenic
1199524737 X:148780198-148780220 CATAATCATCAGATTCACCAAGG - Intronic
1200333407 X:155321254-155321276 CATAATCATCAGATTCACCAAGG + Intronic
1200416884 Y:2921349-2921371 CACAATCATCAGATTCACCAAGG - Intronic
1200451771 Y:3337181-3337203 CATAATCATCAGATTCACCAAGG + Intergenic
1200471692 Y:3593831-3593853 CATAATCATCAGATTCACCAAGG - Intergenic
1201167902 Y:11227680-11227702 CAAAATCATCAGATTCACCAAGG - Intergenic
1201371314 Y:13267974-13267996 CATAATCATCAGATTCACCAAGG - Intronic
1201422122 Y:13811180-13811202 CATAATCATCAGATTCACCAAGG - Intergenic
1201672620 Y:16541168-16541190 CATAATCATCAGATTCACCAAGG + Intergenic
1201693057 Y:16790533-16790555 CATAATCATCAGATTCACCAAGG + Intergenic
1201762094 Y:17551659-17551681 CAGAACACACATATGTACCATGG + Intergenic
1201839458 Y:18354329-18354351 CAGAACACACATATGTACCATGG - Intergenic
1201892469 Y:18957677-18957699 CATAATCATCAGATTCACCAAGG + Intergenic
1202057166 Y:20847142-20847164 CATAATCATCAGATTCACCAAGG - Intergenic