ID: 1046799356

View in Genome Browser
Species Human (GRCh38)
Location 8:118408193-118408215
Sequence CTTTTGTAGCATGTATACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046799356 Original CRISPR CTTTTGTAGCATGTATACAA GGG (reversed) Intronic
902438997 1:16416996-16417018 CTTTTATAACATGTATGCATGGG + Intronic
903156982 1:21452377-21452399 TTTTGGTAGCATGTATCCTAAGG - Intronic
906618373 1:47251990-47252012 CTTTTGTTGCTTGTATAGAATGG - Intronic
906777161 1:48540146-48540168 CATTTGTTGCATATAGACAAGGG + Intronic
911091105 1:94017686-94017708 CGTTTGTAGGAAGTATACATCGG + Intronic
913302888 1:117391535-117391557 CTTTTAGAGCAGGTATAAAAAGG - Intronic
915863170 1:159469344-159469366 CTTGTGCTGCATATATACAAGGG + Intergenic
918030691 1:180806164-180806186 ATTTTCTTGCATGTATAAAATGG - Exonic
918147851 1:181773356-181773378 CTTTTATAGCATCTATAAAATGG + Intronic
918213137 1:182369488-182369510 CTGTTGTCGCATTCATACAATGG + Intergenic
921693333 1:218178188-218178210 CTTTTCTAGCAAGGATTCAATGG + Intergenic
921698569 1:218241073-218241095 CTTTTTTTGCAGGTATTCAATGG + Intergenic
922172355 1:223166409-223166431 CTTTTGTAGAAGGTAAAAAATGG + Intergenic
1063510788 10:6643147-6643169 CTCTTCAAGCATGTACACAAAGG - Intergenic
1067397567 10:45936393-45936415 CCTTTGTAGCAAGTATTCCATGG - Intergenic
1067865884 10:49905487-49905509 CCTTTGTAGCAAGTATTCCATGG - Intronic
1068438687 10:57022708-57022730 CTTTTGTAGGATGATCACAAGGG - Intergenic
1070874209 10:79786654-79786676 CTATTGCAGTATGTATAAAATGG - Intergenic
1071641140 10:87308795-87308817 CTATTGCAGTATGTATAAAATGG - Intergenic
1072627520 10:97122702-97122724 CATTTGTTGAATGAATACAAGGG - Intronic
1072868934 10:99095921-99095943 CTTTCTTTGCTTGTATACAATGG + Intronic
1074175829 10:111001528-111001550 CTATTTTAGCATGTCGACAATGG + Intronic
1077759199 11:5072528-5072550 TTTATTTAGCATGTATACATTGG - Intergenic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1079474845 11:20819426-20819448 TCTTTGCAGCATGTAAACAACGG - Intronic
1079981028 11:27151573-27151595 CTTTGGTTTCATATATACAATGG + Intergenic
1080942557 11:36936268-36936290 ATTTTATAACATGGATACAAGGG - Intergenic
1081092645 11:38891956-38891978 ATTTTGTAGCATGTAGAATAAGG + Intergenic
1081097033 11:38949533-38949555 CATTTGTAGGAAGTCTACAATGG + Intergenic
1081476908 11:43442390-43442412 CTTTTGTAACATGTACCCACAGG - Intronic
1085588403 11:77733407-77733429 CTTTTGTACCAAGTATACTAAGG - Intronic
1085874598 11:80391164-80391186 CTTTTGGAGCAGGTATACTGGGG - Intergenic
1086212258 11:84334782-84334804 CTTTGATAGCATGAATAAAAGGG + Intronic
1086614413 11:88798425-88798447 CTTTTGTAGAATGAATAAATGGG + Intronic
1086897883 11:92334508-92334530 CTTTTGTAGAAGGTATAAAATGG - Intergenic
1088924637 11:114288572-114288594 ATTTTCTAGCAGCTATACAATGG - Intronic
1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG + Intronic
1091517630 12:1200487-1200509 CTTTTATAACATATATACATTGG - Intronic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094011950 12:25819339-25819361 CTTTTTTGGCATGTAAAGAATGG + Intergenic
1094122382 12:26987925-26987947 CTTTTTTGGCAGGAATACAAAGG - Intronic
1094577878 12:31704578-31704600 CTTTAGTATCATGTTTAAAAAGG + Intronic
1095135206 12:38592590-38592612 CTTTTGTAGCAAATATGGAAAGG - Intergenic
1095430137 12:42125242-42125264 GTTTTGTATCATGTTTACAACGG - Intronic
1096221262 12:49829316-49829338 CTTTTGTTGCGAGTATACAAAGG + Intergenic
1098321797 12:69252555-69252577 CTATTGTATCATGTGTAAAATGG + Intronic
1098598658 12:72303086-72303108 CATTTGGAGCATATATTCAAGGG + Intronic
1098961122 12:76740535-76740557 TTTATTTAGCATGTATACACGGG + Intergenic
1099405710 12:82259521-82259543 TTTGTGTAGCATGTGTTCAAGGG - Intronic
1099830382 12:87834863-87834885 CTTTTTTTGTATGTGTACAAGGG - Intergenic
1100709217 12:97236525-97236547 CCTTTGTAGGACGTATGCAATGG - Intergenic
1102567556 12:113806769-113806791 CTTTTATTGCATGTAGTCAAAGG + Intergenic
1106894095 13:34279461-34279483 CTTTTTTATCATCTATAAAATGG + Intergenic
1112064260 13:95775351-95775373 CTTCTGTAGCAGGCAGACAAGGG - Intronic
1112103885 13:96219245-96219267 ATTTTGTAACATGTGTACATTGG + Intronic
1114379158 14:22182650-22182672 TTTTTGTACCAAATATACAATGG - Intergenic
1116538204 14:46062990-46063012 CTTTTGTAGAATATATACAATGG + Intergenic
1116600967 14:46922080-46922102 TTTTTTTAGCATGGATAAAAAGG + Intronic
1119650694 14:76380972-76380994 CGTTTTTAGCATGTATGCACTGG + Intronic
1120208707 14:81613217-81613239 TTTATTTAGCATGTATACATGGG + Intergenic
1123126524 14:105950674-105950696 GTTTTGTAACATGTCTACATAGG + Intergenic
1123407038 15:20026777-20026799 GTTTTGTAACATGTCTACATAGG + Intergenic
1123516369 15:21033433-21033455 GTTTTGTAACATGTCTACATAGG + Intergenic
1124008591 15:25814975-25814997 CTTATGAAGAATGTATACACAGG + Intronic
1124440683 15:29683955-29683977 ATTTTGTGGCATGTTTAGAAAGG + Intergenic
1125374028 15:39009843-39009865 TTTTTAAAGCATGTATTCAATGG + Intergenic
1127148684 15:56051208-56051230 TTTTTATAGCAGGAATACAAAGG - Intergenic
1130943772 15:88534969-88534991 CTTTTGTAGCATCTCAACATTGG - Intronic
1130999814 15:88930988-88931010 CTGTGGTTCCATGTATACAAAGG + Intergenic
1131343206 15:91622061-91622083 CTTTTGTTGCAACTATACAAAGG + Intergenic
1132741827 16:1417809-1417831 CTGTTCTAGCATGCTTACAATGG + Intergenic
1145364990 17:22253833-22253855 CTTTTGTAGAATCTATGAAAGGG - Intergenic
1151065950 17:71150078-71150100 GTTTTGTAAAATGTATGCAATGG - Intergenic
1151404502 17:73877885-73877907 CATTTGGAGCATGGAGACAAAGG - Intergenic
1153155396 18:2143905-2143927 CTTGTGTAGCATCCATTCAAGGG + Intergenic
1153667734 18:7381387-7381409 CTTTTCTGCCATGTATCCAACGG - Intergenic
1156718821 18:40045194-40045216 CTTATCTAGCCTGTATTCAAGGG - Intergenic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1161041412 19:2112621-2112643 CATTTGAAGTATGTATACAGTGG - Intronic
1164179073 19:22804117-22804139 CATTTATAGAATGTATAAAAAGG + Intergenic
1164664622 19:30019271-30019293 ATTATGTACCATCTATACAACGG - Intergenic
924973071 2:148824-148846 CTGCTGTAGCATGGATACATTGG - Intergenic
925365396 2:3307913-3307935 ATTTTGATACATGTATACAATGG - Intronic
925865507 2:8222952-8222974 CTTTTGCAGCATTTGTAGAAAGG - Intergenic
926435881 2:12837367-12837389 GTTTTGTATATTGTATACAAAGG + Intergenic
928489947 2:31771895-31771917 CTTTAGGAGCATGTTTCCAATGG + Intergenic
930759807 2:55021835-55021857 CTTTTGTAGAATATATATATTGG + Intronic
932308562 2:70721396-70721418 TTTTTGAACCATGTATACTAAGG + Intronic
933514235 2:83280289-83280311 TTTCTGTATCATGTATACACAGG + Intergenic
936378012 2:111958914-111958936 ATTTTGTAGTTTGTATTCAAGGG + Intronic
940648688 2:156418661-156418683 TTTATTTAACATGTATACAAGGG + Intergenic
941155213 2:161969517-161969539 CTTTTGTCAAATGTGTACAATGG - Intronic
943469603 2:188277119-188277141 TTTTTATACTATGTATACAATGG - Intergenic
943958964 2:194234417-194234439 CTTTTATAACATGAATAAAATGG + Intergenic
944683735 2:202099633-202099655 CCTTTGAAGCATATAAACAAAGG - Exonic
945490880 2:210453414-210453436 CTTCTGTAGCTTGTATACCTGGG - Intronic
947535349 2:230936901-230936923 CTTTTTATGCTTGTATACAAAGG + Intronic
948682728 2:239647157-239647179 CTTGGGTAGCTTGTAAACAAAGG + Intergenic
1169948671 20:11017435-11017457 CTTTTTTAGCATGTATCTTACGG + Intergenic
1172731450 20:37092234-37092256 ATTTAGTAGCCTGTATCCAAAGG - Intronic
1173169076 20:40708140-40708162 CTTTTCATGTATGTATACAAAGG + Intergenic
1177515356 21:22143663-22143685 ATTTTGATACATGTATACAATGG + Intergenic
1179829370 21:43986797-43986819 CATTTGCACCCTGTATACAATGG - Intergenic
950295110 3:11823063-11823085 CCATTGTAGCAGGTATAGAATGG + Intronic
953250141 3:41238384-41238406 CTTGGGTAGCTTGTAGACAAAGG - Intronic
955148344 3:56342192-56342214 CTTGTGCAGCATTTATAAAATGG - Intronic
955627707 3:60936787-60936809 CTTTGGTAGCATGAACTCAAAGG + Intronic
955703330 3:61703910-61703932 CTTTTGTTGCAGGTAGACCATGG - Intronic
956123008 3:65984875-65984897 ATTTTGTACCATGGAGACAAGGG + Intronic
960222946 3:115137296-115137318 TTTTAGTACCTTGTATACAAAGG + Intronic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
970173796 4:13315974-13315996 ATTTTGACACATGTATACAATGG + Intergenic
970264823 4:14270356-14270378 CTTTTATAACATGTATTCATTGG - Intergenic
970991617 4:22219555-22219577 CTATTGTTGCATCTATTCAATGG + Intergenic
973100362 4:46260564-46260586 CTTTTGTGACATATTTACAAAGG + Intronic
974425092 4:61732481-61732503 ATATTGTAGCATATTTACAAAGG + Intronic
975464517 4:74694281-74694303 CTTTTTTAACATATAAACAAAGG + Intergenic
976418890 4:84814569-84814591 CTTTTGCAGCATATGTACACTGG - Intronic
976995788 4:91431913-91431935 ATTATGTTGCATCTATACAATGG - Intronic
977932055 4:102760407-102760429 CTACTGAAGCGTGTATACAAAGG - Intronic
978700097 4:111632708-111632730 CTTTTGTTGCAGGTAAACCAAGG - Intergenic
979356044 4:119706937-119706959 CATATGCAGCATGTATACACAGG + Intergenic
980372869 4:131901180-131901202 ATTTTGTAGCATTTATGCAGAGG + Intergenic
981297130 4:143145329-143145351 CTTTTGTATAAGGTATAAAAAGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982939130 4:161526347-161526369 CTATTGTAGAATGTTTCCAAAGG + Intronic
984578450 4:181479265-181479287 CTTTTGTGACATGTATACCAAGG - Intergenic
986098635 5:4584933-4584955 ATTTTGTAAGATGTTTACAATGG - Intergenic
986952423 5:13105443-13105465 ATTTTGTTGCATTTATACAAAGG - Intergenic
987160485 5:15136590-15136612 CTTTTCTTGCATGAATACCACGG - Intergenic
987404939 5:17515363-17515385 ATTTTGCAGAATGTATACAAAGG - Intergenic
987412540 5:17629093-17629115 ATTTTGCAGAATGTATACAAAGG - Intergenic
991175459 5:63682648-63682670 CTTTTGAAGAAAGTATAAAATGG + Intergenic
991447824 5:66718763-66718785 CTTTTGTATCATGCATTCGAGGG + Intronic
991494710 5:67215689-67215711 CTTTTGTTGCAAATATGCAAGGG - Intergenic
993224339 5:85147243-85147265 CTTTTGTAGAATATACAGAAGGG + Intergenic
999656417 5:153815132-153815154 CATTTGTAGCAGCTTTACAATGG + Intergenic
1000755576 5:165155109-165155131 ATTGTGTAGCATCTATGCAATGG + Intergenic
1003693908 6:8382904-8382926 CTTCTGAAGAATGTATACACTGG + Intergenic
1005514866 6:26544437-26544459 TTTTGGTAGTATGTATAAAAGGG - Intronic
1005727918 6:28667878-28667900 CTTGTGTAGCACTGATACAAGGG + Intergenic
1008386670 6:50899408-50899430 ATTGTGTTGCATCTATACAATGG - Intergenic
1009847883 6:69156668-69156690 CTTGGGTTCCATGTATACAATGG + Intronic
1010450070 6:75992539-75992561 CTTTGGGGGCATGGATACAAAGG - Intronic
1011184099 6:84655128-84655150 CATTTGTAGCAAGTTTACAAGGG + Intergenic
1014727627 6:124991409-124991431 GGTTGGTAGCATGTATACATGGG - Intronic
1016127136 6:140417839-140417861 CTTTAGTAGCATGTCTAGGAAGG - Intergenic
1017186367 6:151604807-151604829 ATTTTGATGCATGTATACAATGG + Intronic
1018338201 6:162818905-162818927 ATTTTGTTGCATGCATAAAAGGG - Intronic
1018401920 6:163431720-163431742 CCTTTGTAGCCTTTATAAAAGGG + Intronic
1019107434 6:169679935-169679957 CTTTGTTCTCATGTATACAATGG - Intronic
1021040756 7:15859031-15859053 CTTTAAAAGCATATATACAAAGG + Intergenic
1021568807 7:22043578-22043600 CTTTTGGAGCATGGATACTCTGG - Intergenic
1023959959 7:44918205-44918227 ATTTTGTTACATGTATAGAATGG + Intergenic
1024631071 7:51247520-51247542 CTTTTGAAGAAAGTATACAAAGG + Intronic
1027289289 7:76685682-76685704 CTTTTATAGGATGAATACAGAGG + Intergenic
1027838267 7:83274450-83274472 CTTTTGTAGCTGTTATAAAAGGG + Intergenic
1030406847 7:109125842-109125864 CATCTGTAGCATGTTTACATTGG + Intergenic
1030826064 7:114159822-114159844 CTTATTTAACATGTATACATAGG + Intronic
1031754919 7:125626617-125626639 CATCTGCAGCATGAATACAATGG + Intergenic
1036002159 8:4618349-4618371 CTTTTGCAGGATGTCTGCAATGG + Intronic
1040722675 8:50345195-50345217 CTTCTGTACCTTTTATACAATGG + Intronic
1042276212 8:67007743-67007765 GGTTGGTAGCATGTATAGAATGG - Intronic
1043183554 8:77116559-77116581 CAATTGTAGCAGGTCTACAATGG - Intergenic
1043474974 8:80597161-80597183 CACTTGTAGCCTGTGTACAATGG + Intergenic
1043800235 8:84600476-84600498 CTTTTGCAGCCTGTGTAGAAAGG + Intronic
1045044281 8:98259606-98259628 CATTTGTAGCCTGAATTCAAGGG - Intronic
1045335638 8:101201882-101201904 CTTTTGTAGCATTTATATGTGGG - Intronic
1045335657 8:101202109-101202131 TTTTTATAGTATTTATACAACGG + Intronic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1048652085 8:136489334-136489356 CTTTTCAAACATGTACACAATGG + Intergenic
1053637655 9:40029229-40029251 ATTTTGTAGCATTTATGCAGAGG + Intergenic
1053768425 9:41435992-41436014 ATTTTGTAGCATTTATGCAGAGG - Intergenic
1054318448 9:63625823-63625845 ATTTTGTAGCATTTATGCAGAGG + Intergenic
1054547094 9:66347490-66347512 ATTTTGTAGCATTTATGCAGAGG - Intergenic
1054817392 9:69488257-69488279 CTTTTGTAGCATGTTCAGAAAGG - Intronic
1055202206 9:73679178-73679200 ATTTTGATACATGTATACAATGG - Intergenic
1055737652 9:79349281-79349303 ATTTTGTAGAATGGAAACAAAGG - Intergenic
1056004792 9:82257415-82257437 CCTTTGTTCCATGTATAAAATGG - Intergenic
1057765094 9:97909672-97909694 CTACTGTAGCAAGTAGACAAGGG + Intronic
1058032400 9:100214627-100214649 CTTTGCTTCCATGTATACAACGG + Intronic
1187066177 X:15840455-15840477 TTTTTGTGGCATGGATAAAATGG - Intronic
1187356294 X:18575336-18575358 ATTTTCTAGAATGTAAACAATGG - Exonic
1188281112 X:28270751-28270773 CTTTTATAGCATGTGTAATATGG - Intergenic
1189871576 X:45389016-45389038 TTTTTGTAGCAAGTATAAATGGG + Intergenic
1193113130 X:77749833-77749855 CGTATATAGCATGTATACACTGG - Intronic
1193842311 X:86421687-86421709 CTTTTGTAGTATGAATATATTGG + Intronic
1195091743 X:101466983-101467005 CTTTTGTCTCATTTATGCAAAGG + Intronic
1195840331 X:109169125-109169147 CTTTTTGATCATGTATACATGGG - Intergenic
1197662170 X:129186180-129186202 CATTTGTATCAAGTTTACAATGG + Intergenic
1198691073 X:139285308-139285330 TTTTTGAAGCATGTTTATAATGG + Intergenic
1199174250 X:144766100-144766122 CTTTTGTAAAATGTACAAAAAGG - Intergenic