ID: 1046800412 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:118420291-118420313 |
Sequence | TTGTGTGTGTATATATAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1046800409_1046800412 | -10 | Left | 1046800409 | 8:118420278-118420300 | CCTCTGTGTGTGTTTGTGTGTGT | 0: 7 1: 717 2: 3048 3: 3819 4: 6196 |
||
Right | 1046800412 | 8:118420291-118420313 | TTGTGTGTGTATATATAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1046800412 | Original CRISPR | TTGTGTGTGTATATATAGGA GGG | Intronic | ||
No off target data available for this crispr |