ID: 1046800412

View in Genome Browser
Species Human (GRCh38)
Location 8:118420291-118420313
Sequence TTGTGTGTGTATATATAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046800409_1046800412 -10 Left 1046800409 8:118420278-118420300 CCTCTGTGTGTGTTTGTGTGTGT 0: 7
1: 717
2: 3048
3: 3819
4: 6196
Right 1046800412 8:118420291-118420313 TTGTGTGTGTATATATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046800412 Original CRISPR TTGTGTGTGTATATATAGGA GGG Intronic
No off target data available for this crispr