ID: 1046807706

View in Genome Browser
Species Human (GRCh38)
Location 8:118498625-118498647
Sequence GTTCACACCTAGAATTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046807702_1046807706 6 Left 1046807702 8:118498596-118498618 CCCAAACTAAATTCCTGGAAAAG 0: 1
1: 0
2: 3
3: 36
4: 315
Right 1046807706 8:118498625-118498647 GTTCACACCTAGAATTTTCATGG No data
1046807705_1046807706 -7 Left 1046807705 8:118498609-118498631 CCTGGAAAAGGTCAGTGTTCACA 0: 1
1: 0
2: 2
3: 19
4: 187
Right 1046807706 8:118498625-118498647 GTTCACACCTAGAATTTTCATGG No data
1046807703_1046807706 5 Left 1046807703 8:118498597-118498619 CCAAACTAAATTCCTGGAAAAGG 0: 1
1: 0
2: 0
3: 26
4: 181
Right 1046807706 8:118498625-118498647 GTTCACACCTAGAATTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046807706 Original CRISPR GTTCACACCTAGAATTTTCA TGG Intronic
No off target data available for this crispr