ID: 1046810633

View in Genome Browser
Species Human (GRCh38)
Location 8:118529345-118529367
Sequence TTGTGACAATGAAAGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046810633_1046810636 29 Left 1046810633 8:118529345-118529367 CCTTTGGGCTTTCATTGTCACAA 0: 1
1: 0
2: 0
3: 23
4: 180
Right 1046810636 8:118529397-118529419 TTTCTATTTTTAGACATTTAGGG No data
1046810633_1046810635 28 Left 1046810633 8:118529345-118529367 CCTTTGGGCTTTCATTGTCACAA 0: 1
1: 0
2: 0
3: 23
4: 180
Right 1046810635 8:118529396-118529418 TTTTCTATTTTTAGACATTTAGG No data
1046810633_1046810637 30 Left 1046810633 8:118529345-118529367 CCTTTGGGCTTTCATTGTCACAA 0: 1
1: 0
2: 0
3: 23
4: 180
Right 1046810637 8:118529398-118529420 TTCTATTTTTAGACATTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046810633 Original CRISPR TTGTGACAATGAAAGCCCAA AGG (reversed) Intronic
901172649 1:7271965-7271987 TTCTGACAAAGAAAAACCAAGGG + Intronic
905241477 1:36584250-36584272 TTGAGACAAAGGAAGCCCACGGG - Intergenic
907195442 1:52682688-52682710 TTGTGCCAAAGAATGCCCATAGG + Intergenic
908057253 1:60302173-60302195 GTATGACAATAAAAGCACAAAGG - Intergenic
908180401 1:61598566-61598588 TTGTGACATTAACAGCCGAAAGG + Intergenic
909497286 1:76292363-76292385 TTGTGATATTGAAAGCCCACTGG - Intronic
910031886 1:82736110-82736132 TTATGACATTGAAAGCACATAGG - Intergenic
916791554 1:168129703-168129725 ATGACAAAATGAAAGCCCAAGGG + Intronic
917375162 1:174344357-174344379 TTATGAGAACGAAAGTCCAAAGG - Intronic
920228118 1:204452521-204452543 TTGTGACCAAAAAATCCCAAGGG + Intronic
920936690 1:210441570-210441592 TTTTGACAAGGATAGCCCTATGG + Intronic
921236501 1:213137177-213137199 GTGTGGCAGTGAAAGGCCAAAGG - Intronic
921922033 1:220680834-220680856 TTGTGTCAATGAAAAGCCATTGG - Intergenic
921998558 1:221449204-221449226 TTCTGACAATGAAAGGCTAATGG + Intergenic
922543418 1:226435906-226435928 TTGTGACACAGAAAGGGCAAAGG - Intergenic
924887015 1:248229601-248229623 TGGTGACGATGAAAGCCCCCAGG + Intergenic
1065172422 10:23045017-23045039 TTGTTACACTGAAAGGCCAAAGG - Intergenic
1068319492 10:55393045-55393067 TTGTTTTAATGAAAGTCCAAGGG + Intronic
1068695143 10:59959565-59959587 TAGTGAAGATGAAACCCCAAAGG - Exonic
1070677977 10:78426683-78426705 ATGTGACAATAACAGCACAAAGG - Intergenic
1072028495 10:91490999-91491021 TTGTAACAATGATAACCAAAGGG - Intronic
1072303250 10:94082675-94082697 TTCTGTCAATGAAAGCCAATGGG + Intronic
1076185468 10:128444689-128444711 TTATGACACTGAAAGCACAATGG - Intergenic
1079404740 11:20134891-20134913 TTGTGACAAGTAAAGGCTAAAGG + Intergenic
1079913967 11:26345200-26345222 TTGTGACAATCAAAGCATTAAGG + Intronic
1080439196 11:32275234-32275256 TTGTGGCATTGAAAGCGTAAGGG - Intergenic
1082209289 11:49478660-49478682 TAGTCACAATTAAAGTCCAAAGG + Intergenic
1082240360 11:49863202-49863224 TTTTGACAATGAAAGCAGAAGGG - Intergenic
1086120785 11:83302763-83302785 TTGGGACACTGACAGTCCAAGGG + Intergenic
1088983885 11:114888822-114888844 GGGTGACACTGTAAGCCCAAAGG - Intergenic
1089000029 11:115044206-115044228 TAGTGAGACAGAAAGCCCAAAGG - Intergenic
1092660382 12:10732436-10732458 TTGTGAGAATCCAAGCCCACTGG + Intergenic
1095370944 12:41466551-41466573 TGGAGAGAAGGAAAGCCCAAAGG - Intronic
1096271002 12:50166692-50166714 TTGTGACCATGGAAGCCGAGGGG - Intronic
1097493582 12:60300170-60300192 TAGTGCCAATAAAAGCCCATTGG + Intergenic
1098016277 12:66108010-66108032 TTGTGACAGTGGAGGCCTAATGG + Intergenic
1098170141 12:67738437-67738459 TTGTCACAATAACAACCCAATGG + Intergenic
1098624946 12:72653982-72654004 TTCTGACAATGAAATACCTATGG - Intronic
1100223143 12:92528421-92528443 TGGTGTCAATATAAGCCCAAGGG - Intergenic
1101043343 12:100779230-100779252 CTGTGACTATGAAACCCCAGTGG - Intronic
1104606648 12:130194274-130194296 TTGTGACAAAAATAGCCCTAAGG - Intergenic
1105277787 13:18945757-18945779 TTAATACAATGAAAGCCCTAGGG - Intergenic
1106721828 13:32442440-32442462 TTGTGATAATGGTAGCTCAAGGG + Exonic
1107736106 13:43400047-43400069 TGGTGAGAATGAAAGGACAAGGG - Intronic
1109279262 13:60337195-60337217 AAATGACAATGAAAGCCCAAAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111296199 13:86280718-86280740 TTATCTCAATAAAAGCCCAATGG + Intergenic
1113837432 13:113337721-113337743 CTGTGACAAAGCCAGCCCAACGG + Intronic
1115923252 14:38401949-38401971 TTGAGAGAATGAAAGCTCATGGG + Intergenic
1115960372 14:38829819-38829841 TTGTTACATTGAAAGCCTCAAGG - Intergenic
1118226041 14:63900192-63900214 TTGTGAGATTGCAAGCCCAGTGG + Intronic
1120306288 14:82774562-82774584 GGGTGACAATGACAGCACAATGG + Intergenic
1120404799 14:84081297-84081319 TGATGACAATGAAAAGCCAATGG - Intergenic
1124204852 15:27708358-27708380 TTGTGACAATGACAACATAAAGG - Intergenic
1124430273 15:29601363-29601385 TTATGACATTGAAAGCACAAAGG - Intergenic
1124693812 15:31846964-31846986 TAGAGACAATGAAAAGCCAAGGG + Intronic
1125086420 15:35735543-35735565 TTATGACATTGAAAGCTCAAAGG - Intergenic
1127172596 15:56318824-56318846 GTGTGACAATAATAGCACAAAGG - Intronic
1128843039 15:70865770-70865792 TTTTGACACTGAAAGTCCCATGG - Intronic
1131656922 15:94470693-94470715 TTATGACTAGCAAAGCCCAAAGG - Intronic
1133146911 16:3794434-3794456 ATGTGATAATGAAATCCAAAAGG - Intronic
1135919696 16:26638503-26638525 TCCTGACAATGAAAGCACCATGG - Intergenic
1137879958 16:52035540-52035562 CTGTGAAAATTAAACCCCAAAGG - Intronic
1138133910 16:54504865-54504887 TTGTGACAATGAAGGAAAAAGGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1143950362 17:10627772-10627794 AGGTGAGAATGAAAGGCCAAGGG - Intergenic
1146302267 17:31698559-31698581 TTGTGAAGATCACAGCCCAAGGG + Intergenic
1150635428 17:66909878-66909900 TTTTGACAGTGAAAGGGCAAAGG - Intergenic
1151053939 17:71010638-71010660 CTAGGACAATAAAAGCCCAATGG - Intergenic
1153793810 18:8604503-8604525 TCATGACACTGAAAGCTCAAAGG + Intergenic
1153888240 18:9487014-9487036 TTGTGACAATAACAGCATAAAGG - Intronic
1155584173 18:27345713-27345735 TTGTGAAGATTGAAGCCCAAGGG - Intergenic
1157380009 18:47205530-47205552 CTGTGACAATAAAAAACCAAAGG - Intergenic
1159657103 18:71044193-71044215 TTGTTACCATTCAAGCCCAAAGG - Intergenic
1160599591 18:80002506-80002528 TGGTGACAATGAAAGCCTTGAGG - Intronic
1161841386 19:6683150-6683172 TTGTGTCATGGAAAGCTCAAAGG + Intronic
1163941929 19:20503122-20503144 TAGTGACAAAGAAAGCCACAGGG - Intergenic
1164791320 19:30985785-30985807 TTGTGATAATTATAGCACAAAGG - Intergenic
1165753288 19:38275029-38275051 TTGTGACATTGAAAGAGCAAAGG + Intronic
925334888 2:3088963-3088985 TTGTGACAATGACAACATAAGGG + Intergenic
928625334 2:33134044-33134066 TAGAGACAGTGAGAGCCCAAGGG + Intronic
929330973 2:40680284-40680306 TTTTGAAAATGAATCCCCAAAGG - Intergenic
930409905 2:51012407-51012429 TTTTGAAAATGCAAGTCCAATGG - Intronic
930431062 2:51277147-51277169 TGGTGAGAATGCAAGCCCTATGG - Intergenic
930760918 2:55034837-55034859 TTATGACAATAAAAGCACAAAGG + Intronic
933178541 2:79203828-79203850 TTTTTCCAATGAAGGCCCAAAGG + Intronic
936617214 2:114060487-114060509 TTGTTACAATGAATGCCCCAAGG + Intergenic
938204577 2:129408307-129408329 GTATGACAATTAAAGCACAAAGG - Intergenic
940548740 2:155124397-155124419 TTATGACAATGAAACTCCCATGG - Intergenic
942436540 2:175983729-175983751 TTGTGATCATAAAACCCCAATGG + Intronic
942955682 2:181770311-181770333 AGGTAACAATGAAAGCCTAAAGG - Intergenic
944040889 2:195353028-195353050 TTCTGACAATGATATCCAAAAGG + Intergenic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
946386921 2:219388751-219388773 TTGTGACAATAAAAGCAATAAGG + Intronic
946979046 2:225187084-225187106 TAGTGGCAATGAATGTCCAATGG - Intergenic
947101503 2:226625960-226625982 TGGTGACAAGGAAAGACCAAGGG - Intergenic
947220571 2:227787965-227787987 GTGTGAAAAACAAAGCCCAATGG + Intergenic
1170262748 20:14429680-14429702 TAGTGCCAGAGAAAGCCCAAAGG - Intronic
1170451261 20:16486599-16486621 TTTTTACAATGAAAACCAAAGGG + Intronic
1170646188 20:18197834-18197856 TTTTAACAATGAAACCTCAAAGG - Intergenic
1170949029 20:20918349-20918371 TTATGACAATAACAGCCTAAAGG + Intergenic
1174757766 20:53176472-53176494 TTGTTAGAATGAAAAACCAAGGG + Intronic
1175445997 20:59019713-59019735 TTTTAAGAATTAAAGCCCAAAGG - Intronic
1177369955 21:20189484-20189506 ATATGACAATGAAAACCCAATGG - Intergenic
1181076112 22:20378092-20378114 TCCTGACAATGAAAGTCCTAAGG + Intronic
1183223802 22:36535238-36535260 TTGTTAAAATGAAAACTCAAGGG - Intergenic
1183907969 22:41056956-41056978 TTGTGACAATAACAGCACAAAGG - Intergenic
1184029028 22:41880193-41880215 TTGAGACCCTGAAAGCCTAAAGG + Intronic
949576276 3:5341834-5341856 TTTTGACTATGAAAGCCCTGAGG + Intergenic
952326586 3:32325841-32325863 TAGTCACAAAGGAAGCCCAAAGG + Intronic
953124171 3:40075897-40075919 TGATGACAAAGAAACCCCAAAGG + Intronic
956317487 3:67954651-67954673 TCATGACATTGAAATCCCAAAGG + Intergenic
957110360 3:75947838-75947860 TTTGGACAAAGAAAGCCCATGGG + Intronic
957957465 3:87206803-87206825 ATGTGACAATGAAAGGCAGAGGG + Intergenic
958139934 3:89549336-89549358 TTTTGAGAATGAAAGCCACATGG - Intergenic
962877703 3:139548464-139548486 TTCTGAAAATGAAGACCCAATGG - Intergenic
964930562 3:162016813-162016835 TTGTCACAATGAAAGTCATAGGG + Intergenic
965451813 3:168847242-168847264 TTGTGACTATGAAACAGCAAAGG + Intergenic
966991233 3:185233193-185233215 TTGTGACAATAATAGCATAAAGG + Intronic
967352569 3:188530197-188530219 TTCTAACAATGAAAGCCCTTGGG - Intronic
968971331 4:3796954-3796976 TTTCGACAATGAAAGGCCACTGG + Intergenic
969893619 4:10282408-10282430 TTGTGGCAATGAAAAGCAAAAGG - Intergenic
970664395 4:18320181-18320203 GTGTGATAATCACAGCCCAAAGG + Intergenic
971348858 4:25838500-25838522 TTGTGAGAAGAAAAGCCCATTGG - Intronic
971659243 4:29390434-29390456 TTGTGACTATGGCTGCCCAATGG - Intergenic
972231958 4:37083563-37083585 GAGTGACAATGATAGCACAAAGG + Intergenic
975498591 4:75060038-75060060 TCCTGAAAATGAAAGCCCAGTGG + Intergenic
975538132 4:75473615-75473637 TTGTGACCCTGAAAGCCCTCTGG - Intergenic
976221451 4:82759724-82759746 TTTGTACAATGAAGGCCCAAAGG - Intronic
979233514 4:118373164-118373186 GTGTGATAATGAAGGCACAAGGG + Intergenic
979957445 4:126971781-126971803 TTTTTACAATGGAAACCCAATGG - Intergenic
980076982 4:128304029-128304051 TAGTGACTATGAAAGCACTAGGG + Intergenic
982151898 4:152467657-152467679 GTTTGACAGTCAAAGCCCAAAGG - Intronic
982179560 4:152737384-152737406 TTTTGAAAATGAAAGCCGTATGG - Intronic
982929016 4:161378044-161378066 ATTTGACAATGAAAGCAAAAAGG + Intergenic
983957410 4:173714537-173714559 TTGTGATAAAGAATGCCAAATGG - Intergenic
984851650 4:184158726-184158748 TTATGACATTGAAAGCACAAAGG - Intronic
985047967 4:185959687-185959709 TCATGACATTGAAAGCACAAAGG + Intergenic
988143809 5:27277772-27277794 ATGTGTCACTCAAAGCCCAAAGG - Intergenic
988185652 5:27858309-27858331 TTCTAAAAATGAAAACCCAAGGG + Intergenic
989452456 5:41602904-41602926 TTGTGACAATAATAGCACAAAGG + Intergenic
989799363 5:45517790-45517812 TTGTGGCAAAGAAAGCTAAAAGG + Intronic
990296723 5:54408978-54409000 TTGTGACAATTCAAGCCAAAAGG - Intergenic
990645789 5:57843116-57843138 ATGTGAAAATTAAAGCCCAGAGG + Intergenic
991036071 5:62129021-62129043 TGGTGACATTGAAAGGCCTAGGG - Intergenic
994071405 5:95607344-95607366 TAGTAAAAATGGAAGCCCAAAGG - Intergenic
994102905 5:95913454-95913476 TAGTGACAAAGAAAACACAACGG + Intronic
1001285949 5:170424275-170424297 ATGTGACAATGCCAGCCCAATGG - Intronic
1001913264 5:175538747-175538769 TTGTGAGAATGAAAATCTAAAGG + Intergenic
1002794223 6:457795-457817 TTATGACAATAACAGCACAAAGG - Intergenic
1005116415 6:22343165-22343187 TTGTGACATTGCATGCACAAAGG - Intergenic
1006993461 6:38235939-38235961 TAGTGACAATGAAAGACCCCTGG + Intronic
1009507280 6:64500557-64500579 TTGTGTCAATTAAATACCAATGG + Intronic
1009733657 6:67645397-67645419 TTATGACATTGAAAGCTGAAAGG - Intergenic
1010124317 6:72414442-72414464 TTATGACTATGAAAGATCAATGG + Intergenic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010627459 6:78155871-78155893 TTGAGATAATGAAAGGCGAACGG + Intergenic
1011221046 6:85054888-85054910 TTGTGATAGTGAAATCTCAAGGG - Intergenic
1011520134 6:88195876-88195898 TTGTGCCAATTGAATCCCAATGG + Intergenic
1013432866 6:110070946-110070968 TTTTAACAATGAAAACCCTAAGG + Intergenic
1014956590 6:127625860-127625882 ATGTGACACTAAAAGCACAAAGG - Intergenic
1015099384 6:129457506-129457528 TTGAGATAACCAAAGCCCAAGGG - Intronic
1015616616 6:135082790-135082812 TTATGACAATAATAGCACAATGG + Intronic
1017044523 6:150334668-150334690 TTTTCACATTGAAAGCCAAAGGG + Intergenic
1018791428 6:167151223-167151245 TTGTGAAAGAGAAAGCACAAGGG + Intronic
1022285464 7:28953027-28953049 TTTTGACCATGAGAGCCAAAGGG + Intergenic
1022433282 7:30349942-30349964 TTGTGACAATGAGAGGGCATAGG + Intronic
1023111449 7:36815423-36815445 TTGTGACAATAAAAACACAAAGG + Intergenic
1023155062 7:37241785-37241807 GTATGACAATGAGAGCACAAAGG - Intronic
1023795888 7:43791774-43791796 TTATGACATTGAAAGCACAAAGG - Intronic
1024209908 7:47194299-47194321 TTTAGAAAATGAAAGACCAAAGG + Intergenic
1024439722 7:49403304-49403326 TAGTGACCATGACAACCCAATGG + Intergenic
1030760068 7:113339293-113339315 TTATGAAAAGGAAAGCACAAAGG - Intergenic
1032995581 7:137442521-137442543 ATGTGAACATGGAAGCCCAAGGG + Intronic
1038126589 8:24680121-24680143 TTGTGAAAATAACAGCACAAAGG + Intergenic
1038806976 8:30803237-30803259 TCATGACACTGAAAGCACAAAGG + Intronic
1041265148 8:56057456-56057478 TCATGACATTGAAAGCACAAAGG + Intergenic
1041542284 8:58998801-58998823 TTTTGAGTATGAAAGTCCAAAGG + Intronic
1042322530 8:67492309-67492331 TAGTGACATTGAAAGTACAAAGG + Intronic
1042884786 8:73536564-73536586 TTGTGACAGAGAAGGCCAAATGG + Intronic
1044519665 8:93184576-93184598 TTTGGCCAATGAAAGCCCATAGG - Intergenic
1046151616 8:110234167-110234189 TTCTGACAAGGTAAGACCAAGGG + Intergenic
1046810633 8:118529345-118529367 TTGTGACAATGAAAGCCCAAAGG - Intronic
1047383032 8:124381832-124381854 ATGTGTCAATGAAAGCATAACGG + Intergenic
1047412032 8:124631666-124631688 TTCTGACTATGAAAGCCCTCGGG + Intronic
1050332489 9:4559634-4559656 TTGTCACAAGGCAACCCCAAGGG - Intronic
1051013144 9:12443484-12443506 TGGTGAAAATGAAACTCCAAAGG + Intergenic
1051461095 9:17316930-17316952 TTGTGACAATAAAAGCATAAAGG - Intronic
1051595189 9:18818143-18818165 TTGTGGCAGTGAAACCCCTAGGG - Intronic
1052164470 9:25307551-25307573 TTGAAACAATGAAAGCCAAAAGG - Intergenic
1052273986 9:26657632-26657654 TTGTCACAATGAAACCACACAGG + Intergenic
1052593540 9:30529740-30529762 TTGTCACAGTGAAAGCTGAATGG - Intergenic
1058873419 9:109221755-109221777 GTGTGAGAATGAACACCCAAAGG + Intronic
1061856144 9:133442955-133442977 TGGTGACAATGTCAGCCCAGTGG + Intronic
1187204446 X:17168979-17169001 TTATGACAATGAGAGCAGAATGG - Intergenic
1187489797 X:19740295-19740317 TTTTGAGAATGAAGGCCCACTGG + Intronic
1188861111 X:35258141-35258163 TTGTGCAAATGAAGTCCCAAGGG + Intergenic
1190261994 X:48803030-48803052 GTATGACAATCAAAACCCAAAGG + Intronic
1195902253 X:109811313-109811335 TTGTGACATTGAAGGCACCAGGG + Intergenic
1196170698 X:112585337-112585359 TTGTGATAATAAAAACACAAGGG + Intergenic
1198475046 X:136987801-136987823 GTATGACAATGACAGCACAAAGG - Intergenic
1199438165 X:147837566-147837588 TTCAGAGAATGAAATCCCAATGG - Intergenic
1199748995 X:150796641-150796663 TTGTGCCAATTAAATCCCATTGG - Intronic
1199836247 X:151594589-151594611 CCGTGACAATGATAGCACAAAGG - Intronic