ID: 1046814417

View in Genome Browser
Species Human (GRCh38)
Location 8:118568383-118568405
Sequence CAGATCATGCAGGATCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046814411_1046814417 13 Left 1046814411 8:118568347-118568369 CCTAGTAGCAGATGACAGGAGGG 0: 1
1: 0
2: 3
3: 18
4: 208
Right 1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046814417 Original CRISPR CAGATCATGCAGGATCTGGT AGG Intronic
No off target data available for this crispr