ID: 1046815651

View in Genome Browser
Species Human (GRCh38)
Location 8:118580834-118580856
Sequence TAATACCTTCAGCATGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 2, 1: 0, 2: 3, 3: 14, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046815646_1046815651 -1 Left 1046815646 8:118580812-118580834 CCTTCACCTTCAATTTGCAGTTT 0: 2
1: 1
2: 4
3: 22
4: 311
Right 1046815651 8:118580834-118580856 TAATACCTTCAGCATGGGCAGGG 0: 2
1: 0
2: 3
3: 14
4: 160
1046815645_1046815651 4 Left 1046815645 8:118580807-118580829 CCACACCTTCACCTTCAATTTGC 0: 1
1: 0
2: 1
3: 20
4: 311
Right 1046815651 8:118580834-118580856 TAATACCTTCAGCATGGGCAGGG 0: 2
1: 0
2: 3
3: 14
4: 160
1046815647_1046815651 -7 Left 1046815647 8:118580818-118580840 CCTTCAATTTGCAGTTTAATACC 0: 2
1: 0
2: 1
3: 7
4: 176
Right 1046815651 8:118580834-118580856 TAATACCTTCAGCATGGGCAGGG 0: 2
1: 0
2: 3
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046815651 Original CRISPR TAATACCTTCAGCATGGGCA GGG Exonic
901859779 1:12066941-12066963 AAAGAACTTCAGGATGGGCACGG - Intronic
903955652 1:27023559-27023581 TAATAACTTCAGGCTGGGCGCGG + Intergenic
905494456 1:38373652-38373674 TAATCCCTTCAGGATTGGCAGGG + Intergenic
906764888 1:48419993-48420015 TGATAGCTTCAGGATGGGCCTGG + Intronic
912376899 1:109216911-109216933 TAACAGCTTTAGCCTGGGCATGG - Intronic
914339266 1:146744577-146744599 TAATACCCTCAGCAGGGTCTGGG - Intergenic
916622223 1:166511469-166511491 TAATACCTTTATCATGGGAGTGG - Intergenic
916818900 1:168379152-168379174 AAAAGCCTTCAGCATGGCCAAGG - Intergenic
917435946 1:175021427-175021449 AAATACCCACAACATGGGCATGG - Intronic
921625832 1:217376870-217376892 TAGTATCTTCAGAAAGGGCAGGG + Intergenic
921749405 1:218775501-218775523 TAAGACAGTGAGCATGGGCATGG + Intergenic
1065916318 10:30357318-30357340 AAACACCGTCAGCATGGTCATGG + Intronic
1067179395 10:43973415-43973437 TCATACCCTCAGGATGGGCTCGG - Intergenic
1067237159 10:44460710-44460732 GAAAACCTCCAGGATGGGCATGG - Intergenic
1067595931 10:47557348-47557370 TCAGACATTCAGCATGGGGAAGG - Intergenic
1070371169 10:75783631-75783653 TAATACTTACATCATGGTCAAGG - Intronic
1072955500 10:99884616-99884638 TAATAAATTCAGGCTGGGCATGG + Intronic
1074253412 10:111776714-111776736 TGATACATTCTGCATGGGGACGG - Intergenic
1076279254 10:129231679-129231701 AACTACCTTCAGCAAGGACAAGG - Intergenic
1082216283 11:49573692-49573714 TCATGTCTTCTGCATGGGCATGG - Intergenic
1082866365 11:57903308-57903330 TAATCTCTTCAGGATGGGAAGGG + Intergenic
1085649705 11:78256737-78256759 TAATGCCTTATGCATGTGCATGG - Intronic
1087193229 11:95278498-95278520 TAATACCTTCTACATGATCAAGG - Intergenic
1092806123 12:12224908-12224930 TAAAACCTTCTGAATGGCCAGGG + Intronic
1093592494 12:20919779-20919801 ACATAACTTCAGCCTGGGCAAGG - Intergenic
1093834623 12:23812657-23812679 CAATACCTGCATCAGGGGCAGGG + Intronic
1095961796 12:47839536-47839558 TGACACCTCCAGCATGGCCAAGG - Intergenic
1096725535 12:53558808-53558830 TACTACCTCCAGAATGGACAGGG + Intronic
1097566571 12:61277434-61277456 TATTACCATCAACATGGTCATGG + Intergenic
1098761042 12:74425441-74425463 AAATACCTTGAGCATCAGCAAGG - Intergenic
1099848460 12:88059695-88059717 TAATACATTTAGGCTGGGCACGG - Intronic
1100945590 12:99779506-99779528 TAATACTTTCAGCATTTTCAGGG - Intronic
1102841163 12:116124687-116124709 TAAAACCTTCACCAGGTGCAGGG - Intronic
1103062308 12:117868494-117868516 TGTGACCTTCAGCATGGGCCTGG - Intronic
1106775262 13:33002608-33002630 TGACACCTTGAGGATGGGCAAGG - Intergenic
1107875252 13:44785005-44785027 TAGAACCTTCATCATGGGAATGG - Intergenic
1108260181 13:48648120-48648142 TAGTACCCTCAGGATGGGAAAGG + Intergenic
1108318460 13:49262150-49262172 TACTACCTTCAGGTTGGGCATGG + Intronic
1111903309 13:94226780-94226802 TGATACCCTCAACATTGGCAAGG + Intronic
1115387742 14:32817231-32817253 TAATACCCTCTGCATGTGTATGG - Intronic
1116270708 14:42761762-42761784 TAATATGTTCAGAATGGGCTAGG - Intergenic
1117299517 14:54410674-54410696 TAAAATCTCCAGCATGGCCATGG - Intronic
1118103420 14:62630784-62630806 TAAAACTTTCAGCATCAGCAAGG - Intergenic
1119383964 14:74245741-74245763 TAACACTTTCATCATGGGGAGGG - Intronic
1121251532 14:92503326-92503348 TAAAACCTGCAGAATGGCCAAGG - Intergenic
1121530448 14:94649119-94649141 GAATAACTGCAGCATGGGCTGGG - Intergenic
1121620548 14:95344930-95344952 TAATGCCTTAAGAATGGACAAGG + Intergenic
1122674665 14:103401608-103401630 TAAATGCTTCAGCATGGGAATGG + Intronic
1124833739 15:33175357-33175379 TAATTCCTTCAGGTTGGGCATGG - Intronic
1127549787 15:60025614-60025636 TAATACTTTCTTCAGGGGCAGGG + Intronic
1128739111 15:70071522-70071544 AGATACCTCCGGCATGGGCAGGG - Intronic
1129099398 15:73245234-73245256 AAATACCTTCTTCATGTGCAAGG - Intronic
1129491413 15:75929386-75929408 ATATACCTTTGGCATGGGCAGGG + Intronic
1130567338 15:85007991-85008013 TACTACCATCACCCTGGGCAAGG - Intronic
1130707081 15:86243548-86243570 AAATACCTTCAGCATGAGGCTGG + Intronic
1133305490 16:4805559-4805581 TAAAACATTCAGCATTGGCCGGG + Intronic
1134001996 16:10790135-10790157 TAATCTCTTCAGCATTGGGAGGG + Intronic
1138646885 16:58432030-58432052 TAATCCATTCCGCAGGGGCAGGG + Intergenic
1139995009 16:70972775-70972797 TAATACCCTCAGCAGGGTCTGGG + Intronic
1140689822 16:77471051-77471073 TAATACCTTTAGAATGTGCCTGG + Intergenic
1142107479 16:88312600-88312622 AAATAATTTCAGCATGCGCAAGG - Intergenic
1144222354 17:13111601-13111623 TATTACCTTTAGGCTGGGCACGG - Intergenic
1146426104 17:32740763-32740785 TATTACATTCAGGCTGGGCATGG - Intronic
1146739729 17:35272474-35272496 TAATAATCTCAGCATGGGGAAGG + Exonic
1149318516 17:55461040-55461062 TATTACCTTCAGTCTGTGCAAGG - Intergenic
1149975036 17:61256832-61256854 AAATACCATCTGCATGGGCTGGG - Intronic
1150331840 17:64300729-64300751 TAACACCTACAGTGTGGGCAGGG + Intergenic
1150424672 17:65067812-65067834 TAATACCTACAGGCCGGGCATGG + Intergenic
1152415464 17:80158052-80158074 TAATAAATTCAGGCTGGGCACGG + Intergenic
1153158567 18:2177226-2177248 TATTCCTTTCACCATGGGCATGG - Intergenic
1155483949 18:26319883-26319905 TAAAACCCTCAGCATAGGCCAGG - Intronic
1156395887 18:36699591-36699613 TAAGATCTTGAGCATGGACAAGG - Intronic
1157484673 18:48078413-48078435 GCATACCTTCAGGATGGGCAGGG + Intronic
1157938096 18:51895182-51895204 TAAGATCTTCTGCATGGACAGGG - Intergenic
1162120735 19:8465867-8465889 TAATACCTCCACCATCTGCAAGG + Intronic
933210946 2:79568309-79568331 AAGTACCTTCAGCCTGGGCATGG + Intronic
933689429 2:85168267-85168289 TAATACCATCACCATGGTCAGGG - Intronic
934628641 2:95889613-95889635 TAGTACTTTCATCATGGCCAAGG + Intronic
934832593 2:97545480-97545502 TAGTACTTTCAGCATGGACAAGG + Intronic
935676599 2:105599718-105599740 TTATCCCTTCATCATGGGAATGG + Intergenic
935873845 2:107484822-107484844 CAATTCCTTCAGGATGGGAAAGG - Intergenic
935948676 2:108309155-108309177 CAACAACGTCAGCATGGGCATGG + Exonic
936864659 2:117063623-117063645 TAATAGATTAAGCCTGGGCATGG + Intergenic
937487277 2:122328093-122328115 TAATGCCTTCCTCATGGGCAGGG + Intergenic
940315288 2:152321343-152321365 TAATAGTTTCAGAATGGGGAGGG + Intergenic
943326524 2:186505337-186505359 TAATATCTTCAGGATAGTCATGG + Intronic
947452102 2:230218021-230218043 TAATACATGCTGCATGGGCATGG - Intronic
947529188 2:230898124-230898146 TGCTACCTTCAGCAGGGGCCTGG - Intergenic
1170035857 20:11989041-11989063 TAATATCTTCAGCATAGATAAGG - Intergenic
1178221528 21:30666093-30666115 TAATAGCTTCAGCATAGTCTTGG - Intergenic
1181258653 22:21581509-21581531 AAAAACCTTCAGGCTGGGCACGG + Intronic
1181486162 22:23233004-23233026 TAATAGCTTCAGCCTGGACTTGG + Intronic
1182147000 22:28002702-28002724 TAAGAGCTACAGCATGGGCCAGG + Intronic
1185267417 22:49911722-49911744 TAAGACATTCAGACTGGGCATGG - Intronic
949526732 3:4912323-4912345 TAAAACCTTAATCTTGGGCACGG + Intergenic
949912021 3:8919011-8919033 GAATTCCTTCAGCCTGTGCAGGG + Intronic
950445600 3:13035731-13035753 TAAGTCCTTCACCATGGGCTTGG + Intronic
952374630 3:32755823-32755845 TAGTTCCTTCAGCATGTGAAGGG + Intronic
952648780 3:35696663-35696685 TAATACCTTCACCCTGGCAAGGG - Intronic
953302127 3:41787925-41787947 TTTTACCTTCAGCACAGGCATGG - Intronic
955445425 3:59005020-59005042 TAATGCCTTCTCCTTGGGCACGG + Intronic
956275412 3:67495114-67495136 TAATACCTTCAGCATCTTTATGG + Intronic
957297083 3:78346141-78346163 TAATCCCTTCAGGATTGGGAGGG + Intergenic
957465270 3:80581544-80581566 TAATCCCTTCAGGATTGGGAGGG + Intergenic
959500014 3:107096109-107096131 CAAAACTTTCAGCATTGGCAAGG + Intergenic
959917525 3:111834525-111834547 TAATACCATCAGTAAGGTCATGG - Intronic
960821443 3:121737355-121737377 TAAAACCCTCAGCAGGGGCCGGG + Intronic
961422064 3:126814422-126814444 TGATAACTTCAGCATGGGACTGG + Intronic
962332628 3:134492480-134492502 TAATACCTTCACCATCTGCCTGG - Intronic
963662174 3:148140851-148140873 TAATACATTCCGCCTGTGCAGGG + Intergenic
964758235 3:160108392-160108414 AAATATCTTCATCATGGGCTTGG + Intergenic
965843576 3:172936197-172936219 TAATAGCTTCAGGATGGGGCTGG + Intronic
970586920 4:17523166-17523188 TAAGACCTTCTTGATGGGCATGG + Intronic
971034681 4:22680276-22680298 TAAAAGCTACAGCATGGGCTTGG + Intergenic
972816820 4:42654999-42655021 TTATAGCTTCAGCATGTGCTTGG - Intronic
975265682 4:72363821-72363843 TAAAACCTTAAGCGTGGGAAAGG + Intronic
976442846 4:85096045-85096067 CAAAACCTTCATCATTGGCATGG - Intergenic
978852928 4:113359283-113359305 AAATACCTTCAGCATGGTCATGG - Exonic
978987681 4:115034324-115034346 TAATACCTACAGCAAGTGGAAGG - Intronic
980742326 4:136968369-136968391 AAATGCCTTCAGGCTGGGCATGG - Intergenic
981690175 4:147499344-147499366 TAATGACTTCAGGCTGGGCATGG - Intronic
981851970 4:149241910-149241932 TAATGACTTCAGCTTGGGAAAGG - Intergenic
982935099 4:161463557-161463579 TAATACCATCAACTTTGGCAAGG + Intronic
983418633 4:167489731-167489753 TAGTACCATAAGCATGGGCAAGG + Intergenic
983739856 4:171115685-171115707 TACTTGCCTCAGCATGGGCAAGG - Intergenic
984154361 4:176175993-176176015 TAATACTATCAGCATGCTCAGGG + Intronic
984854818 4:184185972-184185994 TAAATCCTTCAGCATGGGTAAGG - Intronic
986574214 5:9196010-9196032 TAATGCCTTCTCCATGTGCAGGG - Intronic
986781011 5:11065907-11065929 TAATCTCTTCAGGATGGGGAGGG - Intronic
990140644 5:52699361-52699383 AAAAACCTACAACATGGGCAGGG + Intergenic
991646381 5:68804352-68804374 TTAAACTTTCAGCATGGCCAGGG + Intergenic
992093093 5:73336804-73336826 AAAACCCTACAGCATGGGCAAGG - Intergenic
992824159 5:80531310-80531332 TAAGGCCATAAGCATGGGCAAGG + Intronic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995621420 5:114030137-114030159 TAATCCTCTCAGTATGGGCATGG + Intergenic
998254708 5:140575754-140575776 TAATACATTCTCCATGGGCATGG + Intronic
999909218 5:156178854-156178876 TAATACATTCAGGCTGGGCGCGG - Intronic
1002796683 6:476900-476922 TAATAACTTCAGGCCGGGCAAGG - Intergenic
1005609555 6:27510553-27510575 TAATACCTTCAGCATGGGCAGGG - Intergenic
1006559444 6:34897253-34897275 TAGTAGCTTCAGCATGTTCACGG + Intronic
1011600132 6:89052155-89052177 TAAGACCATCAGGCTGGGCATGG - Intergenic
1012293435 6:97489044-97489066 AAATAACTTCAGCAAGGTCATGG - Intergenic
1013925403 6:115466262-115466284 TAATAACTACAGGCTGGGCACGG - Intergenic
1018384175 6:163287834-163287856 CAAAACCCTCAGCATGGCCACGG - Intronic
1020641575 7:10761037-10761059 AAATATTTTCAGTATGGGCATGG + Intergenic
1021070469 7:16232340-16232362 TAATGCCTTTATCATGGGAATGG + Intronic
1021392846 7:20115612-20115634 TAATAGTTTAAGCATGGGCAAGG - Intergenic
1024050154 7:45615305-45615327 AAATACCTCCAGGCTGGGCATGG + Intronic
1024436648 7:49364486-49364508 TAACACCTTCAGAAGGAGCATGG - Intergenic
1024564657 7:50671608-50671630 TAACAGCTTCAGCCTTGGCAAGG + Intronic
1024999242 7:55300701-55300723 TAATACCATCACCATGCTCAAGG - Intergenic
1026555768 7:71407423-71407445 TCAGACCTTCAGCAAGGTCAAGG + Intronic
1028579926 7:92398039-92398061 TTTTTCCTTTAGCATGGGCATGG + Intronic
1032211998 7:129924079-129924101 TTATACCTTCAGGATGGGCATGG + Intronic
1034377770 7:150661433-150661455 TAACACCTGAAGCATGGACATGG + Intergenic
1035994837 8:4534223-4534245 AAATACCTTCTGCGTGGGCCTGG + Intronic
1037243051 8:16799475-16799497 TAATACCTTCTGCATGTGCAGGG + Intergenic
1038738317 8:30192657-30192679 TAATACCACCATCATGGGGATGG + Intergenic
1039792681 8:40888136-40888158 TAACTCCTTCAGCATAGGCCAGG + Intronic
1044748378 8:95393361-95393383 TTATACCTTCAGAATATGCAGGG + Intergenic
1045623126 8:104006257-104006279 TAATACCTTCTGGCTGGGCGCGG + Intronic
1046815651 8:118580834-118580856 TAATACCTTCAGCATGGGCAGGG + Exonic
1047842141 8:128764906-128764928 CAATACCATTGGCATGGGCAAGG + Intergenic
1048302710 8:133263282-133263304 TAATACCTTGAGGCTGGGGATGG - Intronic
1052223269 9:26053559-26053581 TAATTCCTTCTGCATAGGGATGG + Intergenic
1057444293 9:95103166-95103188 CAAGCCCATCAGCATGGGCATGG - Intronic
1057666561 9:97050539-97050561 CAATAGCTTCAGCATGGGGCTGG + Intergenic
1057858000 9:98617048-98617070 TTATACCTTCAGAATGTGAATGG - Intronic
1059694376 9:116716836-116716858 TTAGACCTTCAGCTTGAGCAGGG - Intronic
1060099974 9:120831551-120831573 TAATAGCTAAAACATGGGCAAGG - Intronic
1060750521 9:126165523-126165545 TCATCCCCTCTGCATGGGCATGG + Intergenic
1060808409 9:126593791-126593813 TAATACCTATCCCATGGGCATGG + Intergenic
1185805395 X:3052536-3052558 TGATACATTCAGCCTGGGCACGG + Intronic
1186399024 X:9239935-9239957 CAATGCCCTCAGCATGGCCAAGG + Intergenic
1189706810 X:43767148-43767170 TCATTCCTTGTGCATGGGCAAGG + Exonic
1191642495 X:63442457-63442479 TAATATCTTCAGGATTGGGAGGG - Intergenic
1196157890 X:112451063-112451085 TAATACCTTCAGCAATGTCTGGG - Intergenic
1197281648 X:124543775-124543797 CAAGATCTTCACCATGGGCAGGG + Intronic
1202130897 Y:21608368-21608390 TAATCCCAACAGCATGGGCCTGG - Intergenic