ID: 1046817145

View in Genome Browser
Species Human (GRCh38)
Location 8:118597232-118597254
Sequence CTGTCCTATCAGCTGCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046817142_1046817145 17 Left 1046817142 8:118597192-118597214 CCAACGGGGGCTCCTTAGGGCTC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG No data
1046817139_1046817145 24 Left 1046817139 8:118597185-118597207 CCTAGGGCCAACGGGGGCTCCTT 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG No data
1046817143_1046817145 5 Left 1046817143 8:118597204-118597226 CCTTAGGGCTCAGCTTCTAGAAG 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046817145 Original CRISPR CTGTCCTATCAGCTGCTGTT TGG Intronic
No off target data available for this crispr