ID: 1046824214

View in Genome Browser
Species Human (GRCh38)
Location 8:118669624-118669646
Sequence TTGGGGAGGCTGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046824208_1046824214 -6 Left 1046824208 8:118669607-118669629 CCTGTAATTCCAGCATTTTGGGG 0: 22
1: 1025
2: 29906
3: 332894
4: 266273
Right 1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG No data
1046824204_1046824214 13 Left 1046824204 8:118669588-118669610 CCCGGTATGGGATCTCACACCTG No data
Right 1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG No data
1046824205_1046824214 12 Left 1046824205 8:118669589-118669611 CCGGTATGGGATCTCACACCTGT No data
Right 1046824214 8:118669624-118669646 TTGGGGAGGCTGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046824214 Original CRISPR TTGGGGAGGCTGAAGCAGGA GGG Intergenic
No off target data available for this crispr