ID: 1046841138

View in Genome Browser
Species Human (GRCh38)
Location 8:118858520-118858542
Sequence TGCAGGGCTTTGTGGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046841138_1046841149 16 Left 1046841138 8:118858520-118858542 CCAATTGCCCACAAAGCCCTGCA No data
Right 1046841149 8:118858559-118858581 TGCTTCTGTCCCCTCCCTATGGG No data
1046841138_1046841148 15 Left 1046841138 8:118858520-118858542 CCAATTGCCCACAAAGCCCTGCA No data
Right 1046841148 8:118858558-118858580 CTGCTTCTGTCCCCTCCCTATGG No data
1046841138_1046841144 -8 Left 1046841138 8:118858520-118858542 CCAATTGCCCACAAAGCCCTGCA No data
Right 1046841144 8:118858535-118858557 GCCCTGCACTATGGGGCTCCTGG No data
1046841138_1046841154 30 Left 1046841138 8:118858520-118858542 CCAATTGCCCACAAAGCCCTGCA No data
Right 1046841154 8:118858573-118858595 CCCTATGGGCCACCTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046841138 Original CRISPR TGCAGGGCTTTGTGGGCAAT TGG (reversed) Intergenic
No off target data available for this crispr