ID: 1046842938

View in Genome Browser
Species Human (GRCh38)
Location 8:118880990-118881012
Sequence CTCCAATAGCTGATAGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046842938_1046842944 26 Left 1046842938 8:118880990-118881012 CCTTAGTCTATCAGCTATTGGAG No data
Right 1046842944 8:118881039-118881061 ACTCAACTAAGTTCAATACTGGG No data
1046842938_1046842943 25 Left 1046842938 8:118880990-118881012 CCTTAGTCTATCAGCTATTGGAG No data
Right 1046842943 8:118881038-118881060 CACTCAACTAAGTTCAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046842938 Original CRISPR CTCCAATAGCTGATAGACTA AGG (reversed) Intergenic
No off target data available for this crispr