ID: 1046844510

View in Genome Browser
Species Human (GRCh38)
Location 8:118900893-118900915
Sequence ATGAATCAGCCTGGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046844503_1046844510 5 Left 1046844503 8:118900865-118900887 CCATGGCTGTGGGAAAAAGATGG No data
Right 1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG No data
1046844500_1046844510 19 Left 1046844500 8:118900851-118900873 CCTGTGAGGCTGGACCATGGCTG No data
Right 1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG No data
1046844498_1046844510 28 Left 1046844498 8:118900842-118900864 CCTTCATGTCCTGTGAGGCTGGA No data
Right 1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046844510 Original CRISPR ATGAATCAGCCTGGGGAGGA AGG Intergenic
No off target data available for this crispr